ID: 1061506043

View in Genome Browser
Species Human (GRCh38)
Location 9:131032340-131032362
Sequence CAGGGGACCCGGCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061506043_1061506052 10 Left 1061506043 9:131032340-131032362 CCCACCTCCTGCCGGGTCCCCTG 0: 1
1: 0
2: 3
3: 49
4: 377
Right 1061506052 9:131032373-131032395 TTTGCCATGTGCCAGACACTGGG 0: 1
1: 2
2: 19
3: 111
4: 580
1061506043_1061506051 9 Left 1061506043 9:131032340-131032362 CCCACCTCCTGCCGGGTCCCCTG 0: 1
1: 0
2: 3
3: 49
4: 377
Right 1061506051 9:131032372-131032394 ATTTGCCATGTGCCAGACACTGG 0: 1
1: 1
2: 14
3: 106
4: 517
1061506043_1061506054 16 Left 1061506043 9:131032340-131032362 CCCACCTCCTGCCGGGTCCCCTG 0: 1
1: 0
2: 3
3: 49
4: 377
Right 1061506054 9:131032379-131032401 ATGTGCCAGACACTGGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061506043 Original CRISPR CAGGGGACCCGGCAGGAGGT GGG (reversed) Intronic
900371606 1:2334594-2334616 CCGTGGAGCCGGCAGGAGGCAGG + Intronic
900995970 1:6123958-6123980 CAGCGGGGCTGGCAGGAGGTGGG + Exonic
901081962 1:6588682-6588704 GAGGAAACCCAGCAGGAGGTTGG - Intronic
901642724 1:10701223-10701245 CAGGGACCCGGGCAGGAGGCAGG - Intronic
901656326 1:10771872-10771894 CTGAGGACCCGGCATGAAGTTGG + Intronic
901925191 1:12561618-12561640 CAGGGGACTCCCCAAGAGGTGGG - Intergenic
902515264 1:16986550-16986572 CAGCGGCCCCTGCAGGAGGCCGG + Exonic
902638018 1:17747761-17747783 CTGGGGACCCTTCAGGAGGCCGG + Intergenic
902797134 1:18807224-18807246 CAGGGGAAGAGGCAGGGGGTAGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903978854 1:27170737-27170759 CAGGGGATCGGGCAGGAAGCTGG + Intergenic
904893113 1:33794131-33794153 CAGGGTCCCTGGCAGGATGTGGG - Intronic
904917251 1:33979174-33979196 CAGGGGATCTGGCATGGGGTGGG - Intronic
905338326 1:37260558-37260580 GTGGGGGCCAGGCAGGAGGTTGG - Intergenic
906460233 1:46030943-46030965 AAGGAGACCTGGCAGGAGGAGGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
912167280 1:107056596-107056618 CGGGCGACCCCGCAGGAAGTAGG + Intergenic
913287607 1:117241162-117241184 CAGAGGAGCCAGCAGGAGCTGGG - Intergenic
913468229 1:119164778-119164800 CAGGGGCCGAGGCAGGAGGATGG + Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
919791293 1:201292518-201292540 CAGGGGAGGTGGCACGAGGTGGG + Intronic
919802882 1:201364233-201364255 CTGGGGGCCCAGCAGGAGCTGGG + Intronic
919926428 1:202194083-202194105 CAGGGGGCCGGGCAGGCGGTGGG - Exonic
921215945 1:212936828-212936850 CAGGGAACCAGGCAGGTGGTGGG + Intergenic
924709066 1:246519346-246519368 CAGAGGACCCTGGGGGAGGTGGG - Intergenic
1064013598 10:11755787-11755809 CAGAGGAACAGGCAGGCGGTCGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065695250 10:28373692-28373714 CAGGGGACCCAGGGAGAGGTAGG - Intergenic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1065920518 10:30388552-30388574 CATGGGACTGGGCAGGAAGTAGG + Intergenic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1067035356 10:42911598-42911620 GAGGGGCCCAGGCAGGAGGCTGG + Intergenic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1067459081 10:46444261-46444283 CAGGGGACCAGGGAGGTGCTAGG - Intergenic
1067628116 10:47940369-47940391 CAGGGGACCAGGGAGGTGCTAGG + Intergenic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1067828689 10:49597624-49597646 CTGAGGACCCTGCAGGAGGATGG - Intergenic
1069504827 10:68988581-68988603 CAGGGGGCGGGGAAGGAGGTGGG + Intergenic
1070823928 10:79380046-79380068 CAAGAGACCAGGCAGGAGGAAGG - Intergenic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073047015 10:100645460-100645482 CAGGAGACTCGGCAGGGGCTGGG - Intergenic
1075745052 10:124721275-124721297 CAGGGGACCTGCCAGGATGTGGG - Intronic
1075856953 10:125637928-125637950 GAGGGGGCCCGGCAGCAGGGGGG - Intronic
1076024706 10:127101696-127101718 AAGGGGAGCCAGCAGCAGGTGGG + Intronic
1076697815 10:132255614-132255636 CAGGGGGCCCTGCAGGAAGCAGG + Intronic
1076824826 10:132961625-132961647 CCGGGGAGCAGGCATGAGGTGGG - Intergenic
1076824838 10:132961667-132961689 CAGGGGAGCCAGCATGTGGTAGG - Intergenic
1076840041 10:133041360-133041382 CAGGGCACCTGGCAGGAGTCTGG + Intergenic
1076919848 10:133445888-133445910 CAGGGGCCTGGGCTGGAGGTGGG + Intergenic
1077061021 11:617906-617928 CAGGCGACCAGGCAGGAAGTGGG - Intronic
1077152046 11:1076965-1076987 AAGGGGCACTGGCAGGAGGTGGG + Intergenic
1077194728 11:1273653-1273675 CAGGGCACCAGGAAGCAGGTTGG + Intergenic
1077217607 11:1401543-1401565 CAGTGCAGCCTGCAGGAGGTGGG - Intronic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077361896 11:2144521-2144543 CACGGGGCCCGGGAGGAGGGGGG + Intronic
1078068879 11:8095594-8095616 CAGGGGAGACGGCAGCTGGTGGG + Exonic
1078102828 11:8339814-8339836 AAGGAGACCCGGGAAGAGGTTGG - Intergenic
1078397163 11:10991488-10991510 CAGAGAGCCAGGCAGGAGGTCGG - Intergenic
1079003811 11:16778877-16778899 CAGGGAATCCGGCCGGAGGAAGG - Intronic
1081683002 11:45021963-45021985 CAGGGGGCAGGGCAGGAGGGAGG + Intergenic
1083266920 11:61551048-61551070 CAGGGAAGCCGGCGGGTGGTGGG + Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1084165381 11:67372861-67372883 CCGGGGAGCCGGCGGCAGGTAGG - Intronic
1084652366 11:70496689-70496711 CATGGGACCAGGCGGGAGCTGGG + Intronic
1084793338 11:71488953-71488975 CAGGTGACCAGGCAGGAGGGTGG + Intronic
1084943544 11:72626868-72626890 CAGAGGAGGCTGCAGGAGGTTGG - Intronic
1085134558 11:74074363-74074385 CAGGGGACCTGGGTGGAGGCAGG + Exonic
1090384296 11:126347711-126347733 CTGGGGTCTTGGCAGGAGGTTGG + Intergenic
1090398713 11:126435182-126435204 GAGGGAACCCAGCAGGGGGTAGG - Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1093090037 12:14910725-14910747 GAGGGGACTGGGCAGGAGGCTGG - Intergenic
1094327596 12:29256921-29256943 CAGGAGACCACGGAGGAGGTGGG - Intronic
1095939637 12:47717619-47717641 CAGCGGCCCTGGCAGGAGGTGGG + Exonic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096519281 12:52174987-52175009 GAGGGGGCCAGGCAGGAGGTGGG + Intronic
1096839150 12:54370203-54370225 CCTGGGTCCCGGCTGGAGGTGGG + Exonic
1097065045 12:56314992-56315014 CAGGGGACAGGGTAGGGGGTAGG + Intronic
1099131875 12:78842965-78842987 CAGGGGAACAGTCAGGTGGTGGG - Intergenic
1100260610 12:92929163-92929185 GAGGGGACCGGGAAGGAGGTCGG + Exonic
1100263454 12:92954088-92954110 GAGGGGACACGGCAGGAGGTGGG + Intergenic
1100982179 12:100170536-100170558 CAGGGGATGGGGCAGGCGGTTGG + Intergenic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1102039949 12:109794298-109794320 CCGGGGACCGGGCAGGGGCTGGG - Intronic
1102146869 12:110661016-110661038 CAGGGTCCCCGGCACGTGGTAGG + Intronic
1102239301 12:111314027-111314049 CCGGGGACCAGGCAGGAGGGAGG - Intronic
1103555508 12:121763948-121763970 CAGGAGGCCAGGCAGGAGGGGGG - Intronic
1103904987 12:124322551-124322573 CACGGGACCGGGCACCAGGTGGG + Intergenic
1103975635 12:124700948-124700970 AAGGGGAGCGGGCAGGAGGCTGG + Intergenic
1104281088 12:127378409-127378431 CTGGGCACCAGGCAGGAGTTAGG - Intergenic
1104729671 12:131097958-131097980 CAGGAGCCCAGGCAGGAGGCTGG - Intronic
1104797200 12:131528079-131528101 CAGGGCTCCCAGCAGGAGATGGG + Intergenic
1104920612 12:132288681-132288703 CATTGGACCCGGCAGGAGGGTGG + Intronic
1104920656 12:132288852-132288874 CGTTGGACCCGGCAGGAGGGTGG + Intronic
1104920670 12:132288910-132288932 CGTTGGACCCGGCAGGAGGGTGG + Intronic
1106512211 13:30421833-30421855 GAAGGGACCGGGGAGGAGGTGGG + Intergenic
1109290020 13:60462642-60462664 CAAGGGGCAGGGCAGGAGGTAGG - Intronic
1112401679 13:99084204-99084226 CAGAGTACCAGGAAGGAGGTGGG + Intronic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113658394 13:112085961-112085983 AAGGCCACCCAGCAGGAGGTGGG - Intergenic
1114183571 14:20384004-20384026 CAGGGGCCTGGGCAGGAGGGAGG - Intronic
1114613743 14:24057755-24057777 CAGGGGAGCTGGAAGGGGGTAGG - Intronic
1118717889 14:68573278-68573300 GAGGGGGCACAGCAGGAGGTGGG - Intronic
1118836959 14:69484593-69484615 CAGGTGAGCCGGCGGGAGGCCGG - Intergenic
1119195454 14:72714154-72714176 CAGGAGGCATGGCAGGAGGTGGG + Intronic
1121047050 14:90795966-90795988 CAGGGAACCAGGCAGGAGAGGGG + Intronic
1121334712 14:93070230-93070252 GAGGGGGCCCGGCAGCAGGTGGG + Intronic
1121476818 14:94216562-94216584 TAGGGGACAAGGCAGGAGATTGG + Intronic
1121862874 14:97336043-97336065 GAGGGGACCCTGGAAGAGGTGGG + Intergenic
1122112260 14:99510674-99510696 CAGGGGGGACGGCAGGAGGTGGG - Exonic
1122429464 14:101630605-101630627 CAGGGGCCCGGGCAGGAGGCAGG - Intergenic
1122546335 14:102524701-102524723 CAGGAGTCCCTGCAGGAGTTGGG + Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122937390 14:104966503-104966525 CAGGGGCCCTGTCAGGTGGTGGG - Intronic
1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG + Intergenic
1123113256 14:105882652-105882674 CAAGGGTCCCGGCAGGAGCCAGG + Intergenic
1123115130 14:105891087-105891109 CATGGGAACCGGCAGGACATGGG + Intergenic
1123115610 14:105892803-105892825 CAAGGGTCCCGGCCGGAGGCAGG + Intergenic
1123117313 14:105900534-105900556 CATGGGAGCCGGCAGGACATGGG + Intergenic
1123472709 15:20566848-20566870 CAGGGGACGCGGCAGGTGGTTGG - Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123645297 15:22433505-22433527 CAGGGGACGGGGCAGGTGGTTGG + Intergenic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1123682526 15:22772976-22772998 CAGGGGACCCGGTAAGTGGTTGG + Intergenic
1123733014 15:23161839-23161861 CAGGGGACGGGGCAGGTGGTTGG - Intergenic
1123751143 15:23359216-23359238 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124283518 15:28383134-28383156 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124299180 15:28528479-28528501 CAGGGGACGGGGCAGGTGGTTGG + Intronic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124334277 15:28845500-28845522 CAGGGGACCGGGTAGGTGGTTGG + Intergenic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1125833101 15:42729939-42729961 CCTGGGACCGTGCAGGAGGTGGG - Intronic
1126206626 15:46053130-46053152 TAGGGGCCCTGGGAGGAGGTGGG + Intergenic
1127260408 15:57323086-57323108 CAGGGGTCCAGCCAGGAGATGGG + Intergenic
1128151055 15:65363659-65363681 CAGGGGTCCTGGCAGGAGGCGGG - Intronic
1128264195 15:66253364-66253386 CAGGGGGTCCGGCAGGATGTAGG - Intronic
1128704151 15:69826308-69826330 CAAGGGAACCAGCAGGTGGTTGG - Intergenic
1128706813 15:69842678-69842700 CAGGTGGCCTGGCATGAGGTAGG + Intergenic
1128840413 15:70846141-70846163 CATGGGAGGTGGCAGGAGGTGGG - Intronic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1129174776 15:73832128-73832150 CAGGGTCCCTGGCATGAGGTAGG - Intergenic
1129331847 15:74831907-74831929 CAGGGGCCTGGGCAGGAGGAAGG + Intergenic
1129478796 15:75806954-75806976 CATGGGACTGGGCAGGAAGTGGG - Intergenic
1129660071 15:77548495-77548517 CCGGCTACCAGGCAGGAGGTGGG + Intergenic
1129823466 15:78619885-78619907 AAGGGTCCCAGGCAGGAGGTCGG + Intronic
1130510298 15:84583390-84583412 CATGGGACTGGGCAGGAAGTGGG + Intergenic
1130584783 15:85172605-85172627 CATGGGACTGGGCAGGAAGTGGG - Intergenic
1131393269 15:92066735-92066757 CAGGGCACCCGGCAGGCAATGGG - Intronic
1132185447 15:99798792-99798814 GAGGGGACCCTGGGGGAGGTAGG + Intergenic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132727753 16:1346096-1346118 GAGGGGAGCCGGCAGGAGGTGGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133139723 16:3735114-3735136 AAGAGGACCCGCCAGGCGGTGGG - Intronic
1133443243 16:5837887-5837909 CAGAGGACCCCGTGGGAGGTAGG + Intergenic
1133859077 16:9577036-9577058 AAGGGGGCCTGTCAGGAGGTGGG - Intergenic
1134155943 16:11843505-11843527 CAGGTGACCCTCCTGGAGGTAGG - Intronic
1134244060 16:12526779-12526801 CTGTGGACCCCGCAGGGGGTGGG - Intronic
1136012298 16:27371793-27371815 CAGGGAAGCAGGCAGGAGGTGGG - Intergenic
1137551843 16:49442862-49442884 TGGGGGACCCGGCAGGTAGTGGG - Intergenic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1141812220 16:86383252-86383274 CTGGGGAGCCGGGAGGATGTGGG - Intergenic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1142741481 17:1934306-1934328 CAGGGCGCCCGGCAGGCGGCTGG - Intergenic
1142866989 17:2797249-2797271 CAGAGGGCCAGGCAGGAGGCTGG - Intronic
1143159356 17:4859007-4859029 CAGGAAACAGGGCAGGAGGTGGG - Intronic
1143326680 17:6103571-6103593 CAGGGGACCCTGTGGGATGTGGG - Intronic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1143620102 17:8075780-8075802 CAGGGCACCCTGGGGGAGGTGGG - Intronic
1143812040 17:9479802-9479824 CAGGAGAGCTGGCAGGAGGCGGG - Intronic
1144631388 17:16874261-16874283 CAGGGGACGCTGCAAGGGGTGGG - Intergenic
1144649214 17:16997013-16997035 CAGGGGACGCTGCAAGGGGTGGG + Intergenic
1144686419 17:17228976-17228998 CAGGGGGCCAGGGTGGAGGTGGG + Intronic
1146578258 17:34013352-34013374 CAGAGGACCTGGAAGGGGGTGGG - Intronic
1146916222 17:36680082-36680104 CTGGGGACCCGGCAGCAGAAAGG + Intergenic
1147441935 17:40452804-40452826 CAGGGGAGAGGGGAGGAGGTAGG + Intronic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147647115 17:42040509-42040531 CAGGGCATCCAGCAGCAGGTGGG + Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1147924584 17:43938688-43938710 CTGGGGCCCCGGGAGGAGGTCGG - Exonic
1148075532 17:44933372-44933394 CAAGGGAGACGGCAGGAGGGTGG - Intronic
1148486125 17:47991837-47991859 CAGGGGACCCAGCCTGAGATAGG - Intergenic
1149985498 17:61343955-61343977 CTGGGGACCTGGCTGGATGTGGG + Intronic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1150132832 17:62678552-62678574 CAGGGGGCCTGCCAGGAGCTGGG + Exonic
1151478764 17:74357805-74357827 CAGGGGACCCGGCCTGGAGTTGG + Intronic
1152271474 17:79327397-79327419 CCAGGGTCCTGGCAGGAGGTGGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152867387 17:82732358-82732380 CAGGGGAGCCGAGAGGAGATGGG + Intergenic
1154051732 18:10966766-10966788 CGGGGGAAAGGGCAGGAGGTGGG - Intronic
1156493415 18:37510340-37510362 CAGGGGTCCCTGCAGCAGATTGG - Intronic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1159496905 18:69218926-69218948 CAGGGGATCAGGCGGCAGGTGGG + Intergenic
1160018857 18:75165067-75165089 CAGGGTACCCTGTAGGAGCTGGG + Intergenic
1160524791 18:79529170-79529192 CAGGGTACCCAGCCGCAGGTGGG - Intronic
1160708712 19:541048-541070 CAAGGGACCCATCAGGAGCTGGG - Intronic
1160955898 19:1691610-1691632 CAGAGGACACGGCAGGTGGACGG - Intergenic
1161103048 19:2430745-2430767 GAGGAGACCCGCCAGGAGGGAGG + Exonic
1161269772 19:3383389-3383411 CAGGGGTCCTGGCAGGAGCGTGG + Intronic
1161310260 19:3589970-3589992 CAGGGGTCCCAGCGGGAAGTTGG + Intronic
1161585711 19:5104238-5104260 CAGGGGACCCGGGAGCAGAAAGG - Intronic
1161843193 19:6694626-6694648 CTGGGGTCCCTGCAGCAGGTGGG + Exonic
1161968272 19:7561121-7561143 CAGGGGACCCCCCAAGAGGGAGG + Intronic
1163729175 19:18940019-18940041 CAGGGGACCAAGGAGGAGTTTGG + Intronic
1163757124 19:19112675-19112697 AGTGGGACCCGGCAGGAGTTGGG + Exonic
1164562012 19:29299138-29299160 CAGGTGGGCTGGCAGGAGGTGGG - Intergenic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1165395396 19:35560993-35561015 CAGGGCACCAGGGAGCAGGTCGG - Intronic
1165648981 19:37469289-37469311 CAGCGGACCCCGCGGGAGTTGGG + Exonic
1165705768 19:37975275-37975297 CCGGGGACCAGGAAGGAGGATGG + Intronic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1166043979 19:40218601-40218623 GAGGAGAGCAGGCAGGAGGTTGG - Intergenic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1166804502 19:45477304-45477326 CAGGAGACCAGGGAGGAAGTGGG + Intronic
1167609845 19:50501776-50501798 CAGGAGGCCCGGGAGGAGGCTGG - Intergenic
1167705708 19:51079758-51079780 CAGGGAACCGGGCTGGAGGGTGG - Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168297462 19:55384349-55384371 CAGGTGACCAGGCGGGAGCTTGG - Exonic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
925237724 2:2293764-2293786 CAGAGGAGCCGGGAGGAGGGAGG - Intronic
925294120 2:2766556-2766578 CAGGAGGCCCGGGAGGAGCTGGG - Intergenic
925959657 2:9003449-9003471 CCGGGGGCCCGGGAGGAGGGTGG - Intronic
926704291 2:15825909-15825931 CATGGGAGGGGGCAGGAGGTGGG + Intergenic
927495019 2:23546304-23546326 CAGGGGACCCTGCAGAATGAGGG + Intronic
927518940 2:23687821-23687843 CAGGGGACGCGGCTGGAGGGAGG + Intronic
927650282 2:24908841-24908863 CATGGGTCCCGGCAGGAAGCAGG + Intronic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
929771273 2:44894206-44894228 CAGCAGACGCGGCAGGAGGGAGG - Intergenic
929906411 2:46050076-46050098 CTGGGGACCAGGCAGCAGGGCGG - Intronic
932420518 2:71598755-71598777 GAGGGGACGAGGCAGGAGCTGGG - Intronic
932604577 2:73156651-73156673 CAGGAGACCAGGCAGGAGGCTGG - Intronic
933102622 2:78280099-78280121 CAGGGGTCCAGGCAGAAGGCAGG - Intergenic
933610614 2:84430701-84430723 CAGGGGACCAGGCAAGAGAGTGG - Intronic
933721179 2:85398648-85398670 CCTGGGACCCGGCAGCAGGGAGG - Intronic
937135649 2:119549890-119549912 AAGGGGACCCAGCAAGAGTTGGG - Intronic
937904308 2:127045447-127045469 CCGGGGAGCTGGCAGGAGGGCGG + Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938934486 2:136116787-136116809 CAGTTAACCCGGCCGGAGGTGGG + Intronic
944161227 2:196662589-196662611 CAGGCCACCCAGCAGCAGGTGGG - Intronic
946162046 2:217841303-217841325 CAGGGGAGCCAGCAGGGAGTGGG + Intronic
946875796 2:224128659-224128681 CAGGGTCCCTGGCAGTAGGTGGG - Intergenic
947734287 2:232446715-232446737 CAGGGGGCACCGCAGGAGGCAGG - Intergenic
948127584 2:235576141-235576163 GAGGGCACCAGGCAGGAGGCTGG + Intronic
948150949 2:235744323-235744345 GAGGGGCTCTGGCAGGAGGTGGG + Intronic
948479244 2:238239916-238239938 CCGGGGACGCGGCAGGGGCTAGG + Exonic
948902981 2:240965501-240965523 GAGGGTGCCCGGAAGGAGGTGGG + Intronic
1168816611 20:742012-742034 GAAGGGACCAAGCAGGAGGTGGG - Intergenic
1170572834 20:17642090-17642112 CAGGGGTCCCGGCAGGCTGATGG - Intronic
1170586625 20:17739700-17739722 CTTGGGTCCCGGCAGCAGGTTGG - Intergenic
1172204961 20:33156805-33156827 CTGGGCACCAGGCAGGAGGCAGG + Intergenic
1172654378 20:36528025-36528047 CGGGGCACCTGGCAGGAGGCGGG + Exonic
1174431870 20:50476015-50476037 CAAGGGAGATGGCAGGAGGTGGG + Intergenic
1175201029 20:57277773-57277795 CAGGGGCCCCAGCTGGAAGTTGG - Intergenic
1175266547 20:57706877-57706899 CAGGGGAACCAGCAGTGGGTGGG + Intronic
1175727778 20:61331559-61331581 CAGGTGGTCAGGCAGGAGGTGGG - Intronic
1175776277 20:61655803-61655825 CAGGTGACCCTGCAGGTGATGGG - Intronic
1176093790 20:63330349-63330371 TAGGGGACTCGGCAGGGGCTAGG + Intronic
1176140571 20:63543029-63543051 CAGGGGAGCAGCCAGGAGGGTGG - Intronic
1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG + Intronic
1178433135 21:32534179-32534201 AAGGAAACCCGGGAGGAGGTGGG + Intergenic
1178753022 21:35322225-35322247 CAAGTGACCCGGCTGAAGGTAGG - Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1180023600 21:45145510-45145532 CAGGGTTCCAGGCAGGTGGTCGG - Intronic
1180840522 22:18956902-18956924 CAGGGGACCAGGCAGCAGAGAGG - Intergenic
1181060971 22:20281872-20281894 CAGGGGACCAGGCAGCAGAGAGG + Intronic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1182007377 22:26972063-26972085 CAGGGGACAGGGGAGCAGGTTGG + Intergenic
1182442088 22:30370587-30370609 CAGGGAAGCCTGCAGAAGGTGGG + Exonic
1183258337 22:36777572-36777594 GAGGGGAGCCGGCAAGAGGAAGG - Intergenic
1183311067 22:37109719-37109741 CAGGTAAACAGGCAGGAGGTAGG + Intergenic
1183960761 22:41410555-41410577 GAGGGGACATGGCAGGGGGTAGG + Intergenic
1184092278 22:42299072-42299094 CAGGGGTCTGGGCAGGCGGTGGG - Intronic
1184430689 22:44440167-44440189 CTGGGGACCAGGCAAGAGGCTGG + Intergenic
1184511060 22:44933468-44933490 CAAGGGACCCAGCACGGGGTAGG - Intronic
1184969215 22:48003221-48003243 CAGGGGACCTGGAAGGAAGGTGG + Intergenic
1185048234 22:48539893-48539915 CAGGGGTACAGGCAGAAGGTGGG + Intronic
1185287844 22:50010496-50010518 CAGGGCACCTGGCGGGAGGGAGG - Intronic
950490493 3:13301742-13301764 CACTGGACCAGGCTGGAGGTTGG + Intergenic
954035382 3:47848414-47848436 CTGGGGACCAGGCAGGTGGGAGG + Intronic
954123509 3:48514895-48514917 CAGGGGCCCCTGAACGAGGTGGG + Intergenic
954222735 3:49164495-49164517 TCAGGGACCCGGCAGCAGGTTGG - Intronic
954422159 3:50424518-50424540 TAGGGGACCTGGGAGGAGGGAGG - Intronic
954707632 3:52489510-52489532 CAGGGGCCTCGGCTGGGGGTGGG - Exonic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955977173 3:64490185-64490207 TAGGGGACCTGGCAGCAGATGGG - Intergenic
956892194 3:73624060-73624082 CAGGGATCCTGGCTGGAGGTCGG + Intronic
961002161 3:123381260-123381282 CAGGGGTCAGGGCAGGAGCTTGG + Intronic
961749241 3:129085871-129085893 CAGAGGCCCAGGCAGGAGGTGGG + Intergenic
961756156 3:129128414-129128436 CAGAGGCCCTGGCAGGAGGTGGG - Intronic
961805296 3:129485004-129485026 GTGGGGACCAGGCAGGAGGGAGG - Intronic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962872256 3:139507687-139507709 AAGGGGACCCTGTAGCAGGTGGG - Intergenic
964304718 3:155327583-155327605 CAGGGGACCAGGGAGCAGGAGGG - Intergenic
966595155 3:181719429-181719451 CAGGGCAGCCGGCGGGAGGCCGG - Intergenic
966805464 3:183804296-183804318 CGAAGGACACGGCAGGAGGTAGG - Intronic
968046851 3:195629133-195629155 CAGGGCAGCCGGCAGGAGCCAGG - Intergenic
968048119 3:195635366-195635388 CTGGGGACCCGGCAGGTGACGGG - Intergenic
968048189 3:195635520-195635542 CGGGGGACCCGGAAGGGGATGGG - Intergenic
968099215 3:195954100-195954122 CGGGGGACCCGGAAGGGGATGGG + Intergenic
968099283 3:195954254-195954276 CTGGGGACCCGGCAGGTGACGGG + Intergenic
968306422 3:197654401-197654423 CGGGGGACCCGGAAGGGGATGGG + Intergenic
968306492 3:197654555-197654577 CTGGGGACCCGGCAGGTGACGGG + Intergenic
968307803 3:197660911-197660933 CAGGGCAGCCGGCAGGAGCCAGG + Intergenic
968313149 3:197700746-197700768 TAGGGGACCAGGAAGGAGGTGGG - Exonic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
969309865 4:6346965-6346987 CAAGGGGCCAGGCAGGAGGTGGG - Intronic
969322930 4:6424027-6424049 CAGGGTCCCCGGCTGGAGGAAGG + Intronic
969536267 4:7757666-7757688 CAGGAGACCTGGCAGGACGAAGG - Intergenic
969657827 4:8508327-8508349 CAGGGGCTGCGGCTGGAGGTTGG + Intergenic
973330559 4:48906912-48906934 CAGGGGTTCCGGCAAGAGCTGGG - Intronic
979278094 4:118835840-118835862 CCGGGGACGCGGCGGGAGGCCGG - Intronic
980107757 4:128604074-128604096 TAGGAGACCAGGCAGGAGGATGG + Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
984778388 4:183504209-183504231 CCGAGGGCCCGGCAGGAGGCGGG + Intergenic
985628329 5:1001672-1001694 CAGGTGTCCTGGCAGGAGGGAGG + Intergenic
985820179 5:2154259-2154281 GAGGGACCCCGGCAGTAGGTAGG + Intergenic
985914055 5:2904145-2904167 CTCGGGAGCCGGCAGAAGGTCGG - Intergenic
986393136 5:7303512-7303534 CAGGGGACCGGGTAGGTGGTTGG + Intergenic
986410579 5:7475059-7475081 CAGAGGCCCAGGCAGGAGGTGGG - Intronic
986518353 5:8586845-8586867 CAGCGGGCCTGGCAGGTGGTGGG - Intergenic
992443974 5:76818624-76818646 CGGTGGACCCTGCAGGAGGAGGG - Intergenic
992819393 5:80480998-80481020 CAGAGGACCAGAAAGGAGGTTGG + Intergenic
995968362 5:117937754-117937776 CAGTGGACCTGGCAGTAGGAGGG + Intergenic
997303634 5:132823722-132823744 CCGAGGAGCCGGCAGGAGCTGGG + Exonic
997626672 5:135335888-135335910 CAGGGGACCCCGGAGGAGATGGG + Intronic
998037320 5:138927959-138927981 CAGGGGACCAGACAGCATGTCGG - Intronic
998352093 5:141508523-141508545 CAGGGCACCCCCCACGAGGTGGG + Intronic
999141323 5:149364243-149364265 CAGGGGAACCGAGAAGAGGTGGG + Intronic
999279853 5:150357932-150357954 CAGGCGACCCGGCAGGCGCCCGG + Intronic
999328718 5:150658903-150658925 CAAGGGACCCAGCAGCAGGTAGG - Intronic
1001204911 5:169753363-169753385 CAGGGGAGCTGTCAGGGGGTGGG - Intronic
1001559568 5:172660230-172660252 CAGGGGGCCCGGCAGAGGGTCGG + Intronic
1002716870 5:181233606-181233628 AAGGGGACCGGGCAGGGGGTGGG - Intronic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1006101459 6:31688554-31688576 CAGGGGACCTGGGAGGGGTTAGG + Intronic
1006305160 6:33214187-33214209 CTGGGGACCCGGGAGGGGGCAGG - Intergenic
1006333871 6:33410712-33410734 CGGGGGACCAGGCCGGAGGCGGG + Intronic
1006443372 6:34065602-34065624 CTGGGGTCCTGGCAGGAGGCTGG - Intronic
1006836815 6:37004127-37004149 CAGGGGGCCCGGCATCTGGTGGG + Intergenic
1007712749 6:43835035-43835057 CAGGGGACAATGGAGGAGGTAGG + Intergenic
1007726214 6:43917406-43917428 CTGGGGACCGGGCAGGGGGTGGG - Intergenic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1007902541 6:45423845-45423867 CAGGGGACGGGGCGGGAGCTCGG + Intronic
1012581986 6:100880990-100881012 CAGGGGAGCTGGCTGGAGGCGGG - Intronic
1015826359 6:137316804-137316826 CAGTGGTTCTGGCAGGAGGTAGG - Intergenic
1018158626 6:161014901-161014923 TTGGGGACCGGGCAGGGGGTTGG - Intronic
1018171752 6:161148985-161149007 CAGAGGATCCGGAAGGAGCTGGG + Intronic
1019579180 7:1751597-1751619 CAGGGAGCCCAGCAGGAGATGGG - Intergenic
1019746283 7:2701986-2702008 CAGGGGCCGGGTCAGGAGGTGGG + Intronic
1019923373 7:4177016-4177038 AAGTGGACCAGGCAGGAGGGAGG + Intronic
1020276986 7:6630560-6630582 GAGGGCACCTGGCAGGTGGTGGG - Intergenic
1023202120 7:37709941-37709963 CAGGGAACCCGGCAGGCATTTGG - Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1023939369 7:44760091-44760113 CAGGGGGCCCGGCAGGGGTCAGG + Intronic
1028930239 7:96404819-96404841 CATGGAACCAGGCTGGAGGTGGG + Intergenic
1029118726 7:98252198-98252220 CCGGGGACCGGGCAAGAGGGTGG + Exonic
1029270598 7:99374815-99374837 CAGGGGAGCCACCTGGAGGTGGG + Intronic
1029283064 7:99449117-99449139 CAGGGAGCCCGGCAGGAGGCTGG + Intronic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1032450824 7:132029448-132029470 CAGGTGACCAGGAAAGAGGTTGG + Intergenic
1032841938 7:135721355-135721377 CAGGGACCCAGGCAGGGGGTGGG + Intronic
1033200379 7:139363087-139363109 CAGGGGGACTGCCAGGAGGTGGG + Intronic
1033227218 7:139571574-139571596 CAGGGAAGCCAGCAGGAGCTAGG - Exonic
1034825225 7:154256320-154256342 CAGGGGCCCCTGCAGAAGGCAGG + Intronic
1035021785 7:155804776-155804798 CAGGGGGCCGGGGAGGAGGGCGG + Intronic
1035356935 7:158281623-158281645 CACGGGACGTGGCAGGAGGGGGG - Intronic
1035784643 8:2250992-2251014 CTGGGGAACCTGCAGAAGGTTGG + Intergenic
1035808164 8:2470721-2470743 CTGGGGAACCTGCAGAAGGTTGG - Intergenic
1037598586 8:20374613-20374635 TAGAGGAGCCGGGAGGAGGTTGG - Intergenic
1037884432 8:22589012-22589034 CCGGGGACCGGGCAGCAGGAAGG - Intronic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038492600 8:27981513-27981535 GGGGAGCCCCGGCAGGAGGTGGG - Intronic
1038899810 8:31829805-31829827 CAGGTGACAAGGCAAGAGGTGGG + Intronic
1039892925 8:41696801-41696823 CAGCTGGCCCGGGAGGAGGTGGG - Intronic
1040435174 8:47383173-47383195 CAGAGCACCTGGCAGGAGGCTGG - Intronic
1040555155 8:48471802-48471824 CAGGGGACTCTCCAGTAGGTTGG + Intergenic
1043284369 8:78511400-78511422 CAGGAGACCTGGCAGGAAATGGG + Intergenic
1043401909 8:79892071-79892093 GAGGCGCCCCGGCAGGAGGTCGG - Intergenic
1043534983 8:81192986-81193008 CTGGGGACTCGGGGGGAGGTTGG - Intergenic
1044973753 8:97644270-97644292 CAGGAGACCCGGGAGGCGGGAGG - Exonic
1045320805 8:101080361-101080383 CAGGGGACCAGGCAGGAGACAGG + Intergenic
1047252745 8:123192975-123192997 CAGGGGAAGCGGCTGGAGGCAGG + Intronic
1049101301 8:140580686-140580708 CATGGGAGGAGGCAGGAGGTAGG + Intronic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049199877 8:141334805-141334827 CCGGGCACCCAGCAGGAGGCTGG - Intergenic
1049420426 8:142513995-142514017 CAGGGGTCCCAGCAGGAGTGAGG + Intronic
1049479968 8:142817942-142817964 CGGTGGACCAGGCAGGAGGAGGG + Intergenic
1049651441 8:143771642-143771664 CCGGGGGCCAGGCAGGAGGCAGG + Intergenic
1050302346 9:4272468-4272490 AAGCACACCCGGCAGGAGGTGGG - Intronic
1050874239 9:10614383-10614405 CAGGGAACCCGGCAGCGCGTGGG - Intergenic
1053586545 9:39464487-39464509 GAGGGCAGACGGCAGGAGGTGGG + Intergenic
1054579762 9:66900746-66900768 GAGGGCAGACGGCAGGAGGTGGG - Exonic
1056334214 9:85550226-85550248 CAGGGGATCTGGAAGGAGCTAGG + Intronic
1056743393 9:89279692-89279714 CAGGAGACACGGCAGGAGCTAGG - Intergenic
1057076635 9:92141531-92141553 CAGGGGGCCGGGCAGGCGGTAGG - Intergenic
1060135597 9:121150372-121150394 TGGGGGCCCCAGCAGGAGGTGGG - Exonic
1060200373 9:121648928-121648950 CAGGGGCGCCGGCGGGAGGTGGG + Intronic
1060583238 9:124770667-124770689 GAGGGGACCCGGGGGGAGGAGGG + Intronic
1061063877 9:128265556-128265578 CAGGGGACGGGGCAGGCAGTTGG + Intronic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG + Intergenic
1062039265 9:134396642-134396664 CAGGGTGCCCGGGAGGAGGGAGG - Intronic
1062702245 9:137913395-137913417 CAGGGAACCAGGCAGGAGGAAGG + Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1189308673 X:40005708-40005730 GAGGGGGCCGGGCCGGAGGTGGG - Intergenic
1189333599 X:40156941-40156963 GACTGGACCGGGCAGGAGGTGGG + Intronic
1192210321 X:69123693-69123715 CAGAGCACCTGGCAGGGGGTGGG - Intergenic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1195654891 X:107324414-107324436 CCAAGGACCCGGCAGGAGCTAGG + Intergenic
1197280888 X:124534656-124534678 CAGGGGATCTAGCAGCAGGTGGG + Intronic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1198179678 X:134194104-134194126 CTGGGGGCCTGTCAGGAGGTGGG + Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199980058 X:152916002-152916024 CATGGGACCTGGCAGGTAGTGGG - Intronic
1199993275 X:153002144-153002166 CAGGGTTCCAGGCAGGAGATGGG - Intergenic
1200079113 X:153566794-153566816 CAGGGGACGCAGCGGGAGTTGGG - Intronic
1200128267 X:153828451-153828473 AAGGAGACCCGCCAGGAGGAGGG - Intronic
1200247699 X:154534735-154534757 CCGGGGACCCAGCATGAGGCAGG - Intronic