ID: 1061506452

View in Genome Browser
Species Human (GRCh38)
Location 9:131034347-131034369
Sequence GTTTAGGCAGGCAGCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061506452_1061506456 -9 Left 1061506452 9:131034347-131034369 CCTGGGGTGCTGCCTGCCTAAAC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1061506456 9:131034361-131034383 TGCCTAAACTGGGCCTTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061506452 Original CRISPR GTTTAGGCAGGCAGCACCCC AGG (reversed) Intronic
900110211 1:1002050-1002072 ATTCAGGCCGGCAGCTCCCCTGG - Intergenic
901686866 1:10948037-10948059 GGTGAGGCTGGCAGCGCCCCTGG - Exonic
902242180 1:15096441-15096463 GGCTGGGCAGGCCGCACCCCTGG - Intronic
902529245 1:17079931-17079953 TTATAGGCAAGCACCACCCCTGG + Intronic
902985149 1:20150267-20150289 GTGGGGGCAGGCAGGACCCCTGG - Exonic
904453546 1:30632428-30632450 GTTGAGGCAGGGAGCATCCCAGG + Intergenic
905239100 1:36571079-36571101 GCTGAGGCAGGCAGGACACCTGG - Intergenic
911154921 1:94627916-94627938 GTGGAGGCAGGCAGCAGCTCAGG - Intergenic
912424339 1:109573333-109573355 GTATAGGCAGGCAGCAACAGAGG + Intronic
912579530 1:110707547-110707569 GCTTTGGGAGGTAGCACCCCTGG - Intergenic
914451136 1:147792636-147792658 CTCTAGGCAGGCAGCTCCCTAGG - Intergenic
915075594 1:153306139-153306161 GTTTTGGCCCCCAGCACCCCTGG - Intronic
915270331 1:154749344-154749366 TTAAAGGCAGGCAGCTCCCCAGG + Intronic
915915168 1:159936589-159936611 GCAGAGGGAGGCAGCACCCCAGG + Intronic
917709040 1:177665913-177665935 GTTTAGCCAATCAGCAACCCTGG + Intergenic
924270233 1:242324926-242324948 ATTTAGGCAGGCAGGAGCCTAGG - Intronic
1066714685 10:38273834-38273856 ATTTAGGCAGGCAGGAGCCTAGG + Intergenic
1066783388 10:38976875-38976897 ATTTAGGCAGGCAGGAGCCTAGG - Intergenic
1069747710 10:70726387-70726409 GTGGAGGAAGGCAGCAGCCCTGG + Intronic
1074397331 10:113108632-113108654 GCCTAGGCTGGCAGCACCGCGGG + Intronic
1075127987 10:119715982-119716004 CTGCAGGCAGGCAGCAGCCCCGG + Intergenic
1076647136 10:131961235-131961257 GCTTTGGCAGGCAGCCCCCTCGG - Intergenic
1081249442 11:40811808-40811830 CTTTAGGCAGGCTGCTCCCTTGG + Intronic
1083191707 11:61056973-61056995 TTTTGTGCAGGCAGCACTCCAGG - Intergenic
1083467260 11:62856679-62856701 GTTGCAGCAGGCAGCACCGCCGG - Intronic
1083601533 11:63951684-63951706 GATGAGGCAGGCAGGACTCCTGG + Intronic
1084170431 11:67398341-67398363 GTGCAGGCAGGAAGCAGCCCTGG + Exonic
1088613523 11:111602040-111602062 GTTTTGGCGGGAAGGACCCCGGG + Intergenic
1091061777 11:132470209-132470231 GTTAAGGCAGGAAGCACCAGTGG + Intronic
1091670231 12:2447280-2447302 GTTTAGGGAGGCAGCTGCCTTGG - Intronic
1092953892 12:13531852-13531874 GGTTAGGCAGGCTGTCCCCCAGG - Intergenic
1095160127 12:38905789-38905811 CTTCCGGCAGGCAGCAGCCCGGG + Intronic
1104536319 12:129621281-129621303 GTTTGGGCAGGAAGGCCCCCTGG - Intronic
1107636585 13:42398384-42398406 GTTTAGGAAGTCAGCTCCTCAGG + Intergenic
1112652556 13:101415840-101415862 GTTTACCCAGGCAGCGGCCCTGG + Intronic
1113736339 13:112681005-112681027 GTGAAGGCAGGAATCACCCCTGG - Intronic
1117092875 14:52268055-52268077 GCGTAGGCAGCCAGCACCACCGG - Exonic
1118755179 14:68837826-68837848 GTTTACGCAGGCTGAACTCCTGG - Intergenic
1122140225 14:99659269-99659291 GTTAAGGCGGACAGCATCCCAGG + Intronic
1122835234 14:104427547-104427569 GACTAGGGAGGCACCACCCCCGG + Intergenic
1123842098 15:24259072-24259094 GTTTGTGCAGGAAGCACCCAGGG - Intergenic
1129706053 15:77795217-77795239 GTCAAGCCAGGCAGCAACCCAGG + Intronic
1130384560 15:83399953-83399975 GTCTTGGCAGGCAGCACCTGGGG - Intergenic
1132222642 15:100116615-100116637 GTTGAAGCAGGCAGCAGGCCAGG - Intronic
1134247086 16:12548032-12548054 GGTAAGGCAAGCACCACCCCTGG + Intronic
1139330892 16:66189109-66189131 GTTTAGGCAGAGAGAACACCAGG + Intergenic
1141410805 16:83831635-83831657 GTTTATGCAAGCACCTCCCCAGG - Intergenic
1141925279 16:87164365-87164387 GTTGAGGCAGGCAGAACACGAGG + Intronic
1147661739 17:42120684-42120706 GGTAAGGCAGGCAGCGCCCTTGG - Exonic
1151551812 17:74826710-74826732 GTGTAGGCAGGTGCCACCCCAGG + Intronic
1152684915 17:81689199-81689221 GAGCAGGCAGGCAGCACCCGTGG + Intronic
1152908806 17:82985107-82985129 TTTCAGGCAGGCACCACCCCAGG + Intronic
1160667020 19:335704-335726 GGCGAGACAGGCAGCACCCCGGG - Intronic
1160805324 19:990028-990050 GTGTGGGCAGCCAGGACCCCTGG - Intronic
1160812246 19:1017873-1017895 CTGGAGGCAGGAAGCACCCCGGG - Intronic
1161946348 19:7439765-7439787 GTTTTGGCATGAAGCACGCCAGG + Exonic
1162814245 19:13183732-13183754 GCTTAGGCAGCGAGCACCCAGGG - Intergenic
1163566022 19:18051926-18051948 GTTTCGGCAGGAACCGCCCCGGG + Intergenic
1165993329 19:39828033-39828055 ACTTAGCGAGGCAGCACCCCTGG + Intronic
1166125062 19:40710172-40710194 GGTTAGGCTGGGGGCACCCCAGG - Intronic
1166774598 19:45304729-45304751 GCTGAGGCAGGCATCACCTCTGG - Intronic
1167497823 19:49829842-49829864 GTTTGAGAAGGCAGCCCCCCCGG + Exonic
1167553041 19:50174172-50174194 CTATAGGCATGCACCACCCCTGG - Intergenic
925263432 2:2547616-2547638 GTCTTGGCAGGCAGCCTCCCTGG - Intergenic
931620382 2:64204262-64204284 GTTCACGCAGAGAGCACCCCAGG + Intergenic
935185528 2:100728726-100728748 CTGTAGGCATGCACCACCCCTGG + Intergenic
936038403 2:109130003-109130025 GGCGCGGCAGGCAGCACCCCGGG + Exonic
937543435 2:122987763-122987785 CTTTATGCAGGCAGCAACACAGG - Intergenic
938794651 2:134707311-134707333 GTGTAGGCAGGCACCACAGCTGG + Intronic
939162052 2:138602259-138602281 CTTTTGGCAGGCAGCAACCCTGG + Intergenic
940270309 2:151882956-151882978 GTGTTGGCAGACAGCCCCCCAGG - Intronic
944436519 2:199695966-199695988 GTGCAGCCAGGCAGAACCCCAGG - Intergenic
946028081 2:216684277-216684299 TTTTAGGCAGGCAGGTCTCCTGG - Intronic
1170465128 20:16615845-16615867 ATTTAGGCAAGCAGCACGTCTGG - Intergenic
1173826159 20:46048961-46048983 GGTTGGGCATGCAGCACCCAGGG - Intronic
1175574258 20:60048908-60048930 GATCAGTCAGGCAGCAGCCCTGG - Intergenic
1178719546 21:34996198-34996220 GTTTAGGCAGGCCTGACCCCTGG - Intronic
1179132337 21:38649226-38649248 GCTGCGGCAGGCAGCACCCAGGG + Intronic
1182640526 22:31763357-31763379 GTTGAGGCAGGCAGATCACCTGG - Intronic
1185237263 22:49721453-49721475 GTTCAGGCTGGGAGCCCCCCGGG - Intergenic
1185334140 22:50264009-50264031 GCTAGGGCAGGCAGCACACCTGG - Exonic
949919632 3:8990716-8990738 GCTGGGGCAGGCAGCAGCCCGGG + Exonic
952969959 3:38644557-38644579 GTGGAGGTAGGCACCACCCCTGG - Intronic
956235371 3:67064037-67064059 GTTTAGGCATGCTGCACACCTGG + Intergenic
961199525 3:125033261-125033283 GTTGAGGCTGGCAGCTGCCCTGG + Intronic
962420597 3:135225669-135225691 GTTTAGGAAGGCCACACCTCAGG + Intronic
962675955 3:137758852-137758874 GTTGAGCCAGGAATCACCCCAGG + Intergenic
964197670 3:154082995-154083017 GTTTATGCAGGAAGTACCACAGG - Intergenic
969845622 4:9918003-9918025 GTCTGTGCAGGCACCACCCCTGG + Intronic
969999086 4:11345673-11345695 GTTCAGGGAGGAAGCTCCCCAGG - Intergenic
976612659 4:87045945-87045967 GTTTTGGGAGCCAGGACCCCAGG + Intronic
979468355 4:121067906-121067928 GTTTAGGAAGGAAGCAGCCAAGG + Intronic
982679492 4:158411583-158411605 TTTTTGGCAGGCACCACCCAAGG + Intronic
984521432 4:180806583-180806605 GTTGAGGCAGGCAGATCGCCTGG - Intergenic
985726711 5:1520025-1520047 ATCCAGGCAGGCAGCACCCAGGG + Intronic
987509037 5:18811845-18811867 GTTAAAGCAAGCAGCACCGCCGG - Intergenic
995553900 5:113308180-113308202 ATTTAGACAGGCACCACCCTGGG - Intronic
998138418 5:139686764-139686786 GGTTATGCAGGCAGCATCACAGG - Intergenic
1001398460 5:171433050-171433072 GGAAAGGCAGGAAGCACCCCGGG - Intronic
1002320248 5:178371289-178371311 GTGTCACCAGGCAGCACCCCAGG + Intronic
1002619208 5:180475018-180475040 GTTTCAGCAGGCAGCTGCCCAGG - Intergenic
1009988704 6:70814119-70814141 CTTTTGGCAGGCAGCAAACCAGG - Intronic
1020678666 7:11209299-11209321 GTTTAGGAAGGTAGCACACGGGG - Intergenic
1022517222 7:30983813-30983835 GCTCAGGCAGGCAGCACCGTCGG - Intronic
1024280000 7:47710763-47710785 GTATAGGCTGGCTCCACCCCAGG + Intronic
1026375557 7:69746913-69746935 CCTTAGGCAGGCAGCATCCAAGG - Intronic
1035640914 8:1184642-1184664 TTTTCAGCAGGCAGCACCCTCGG + Intergenic
1035676582 8:1460978-1461000 GTTTATGGAGGCAGAAACCCAGG - Intergenic
1042575892 8:70218259-70218281 GTTTAGGGAGGCTGCACCACTGG + Intronic
1045656878 8:104396184-104396206 GTGTAGGAATGCAGCAGCCCAGG - Intronic
1048970800 8:139643944-139643966 ATCTAGGCAGACACCACCCCGGG - Intronic
1049672190 8:143874895-143874917 CTTGAGGCAGCCACCACCCCCGG + Intronic
1049683013 8:143928072-143928094 GGCTTGGCAGGCAGCACCCTGGG - Intronic
1049874772 8:145009381-145009403 GTTTATGCTGTCAGCTCCCCTGG - Intergenic
1056299961 9:85230565-85230587 GTTCAGGCAGAGAGCACACCTGG + Intergenic
1057151178 9:92797478-92797500 GTTGACACAGGCAGGACCCCTGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1061506452 9:131034347-131034369 GTTTAGGCAGGCAGCACCCCAGG - Intronic
1062685065 9:137808303-137808325 GGGTAGGCAGGCAGGGCCCCCGG - Intronic
1192880038 X:75274044-75274066 GTCTAGGCAGGCAGTACGTCTGG + Intergenic
1194956518 X:100187546-100187568 GTTTAGGAAGGCAGCTCCTTAGG + Intergenic
1196703233 X:118694285-118694307 GTTTAGATAAACAGCACCCCTGG + Intergenic
1200696353 Y:6364471-6364493 GAGTAGGCTGGCAGCACTCCAGG - Intergenic
1200704107 Y:6426866-6426888 GGTTAGGCTGGCTGCACTCCAGG - Intergenic
1201030004 Y:9737842-9737864 GGTTAGGCTGGCTGCACTCCAGG + Intergenic
1201037761 Y:9800229-9800251 GAGTAGGCTGGCAGCACTCCAGG + Intergenic