ID: 1061509490

View in Genome Browser
Species Human (GRCh38)
Location 9:131051821-131051843
Sequence TACTGGGAAAGGAGGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061509480_1061509490 1 Left 1061509480 9:131051797-131051819 CCACTGGGAAAGGAGGAGGGAGG 0: 1
1: 0
2: 10
3: 98
4: 709
Right 1061509490 9:131051821-131051843 TACTGGGAAAGGAGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061509490 Original CRISPR TACTGGGAAAGGAGGAGGGA GGG Intronic
No off target data available for this crispr