ID: 1061509965

View in Genome Browser
Species Human (GRCh38)
Location 9:131054376-131054398
Sequence GCCTCCCAAAACATTACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061509965 Original CRISPR GCCTCCCAAAACATTACCCA TGG (reversed) Intronic
902489434 1:16770362-16770384 GCCTGGCAGAACATTCCCCATGG - Intronic
904483672 1:30809981-30810003 GCCTCCAACACCCTTACCCAGGG + Intergenic
904489942 1:30852344-30852366 GCCTCCCATAACCCTGCCCAGGG - Intergenic
915570798 1:156744114-156744136 GCCCCCCTCAACATTCCCCATGG - Intronic
923531003 1:234812163-234812185 GCCTGGCAGAACATTCCCCATGG + Intergenic
1067779150 10:49186357-49186379 CCCTCCCAAAATATTTCACAGGG - Intronic
1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG + Intergenic
1071779073 10:88822793-88822815 CTCTTCCAAAACATTAACCATGG + Exonic
1071914185 10:90272576-90272598 TCCTCCCAAAATGTAACCCAGGG - Intergenic
1078334347 11:10451603-10451625 GCCTCTCAAAACTCTCCCCAGGG - Intronic
1079987367 11:27213132-27213154 GTCTCCCAATTCCTTACCCAGGG + Intergenic
1091493682 12:953751-953773 GCCTGCCACAGCATTTCCCATGG + Intronic
1094267091 12:28571660-28571682 GCCCACCCAAACATTACACAAGG - Intronic
1097190580 12:57217553-57217575 GCCTCCCATCACATTTCCCACGG + Intronic
1099987676 12:89686529-89686551 ACCTTCCAAAAAATTTCCCAAGG + Intronic
1100997571 12:100319337-100319359 GCCTCACAAAACATTCCCACAGG + Intronic
1101520519 12:105478236-105478258 TTCTCCCAGGACATTACCCATGG - Intergenic
1102790898 12:115644338-115644360 GCCTCCCAAGACAGAATCCAGGG - Intergenic
1104401940 12:128483387-128483409 GACTCACAAATGATTACCCAGGG - Intronic
1107806172 13:44155962-44155984 GCTTCCCTAAACACCACCCAGGG + Intronic
1107860091 13:44652343-44652365 GCCTGCCAAAACATTTCACTGGG + Intergenic
1109584736 13:64384553-64384575 GATTCCCAAAATATTACCAAAGG + Intergenic
1109601448 13:64635084-64635106 AACTCCCAAAGTATTACCCAAGG + Intergenic
1112086564 13:96038494-96038516 GGCTACCACACCATTACCCAAGG + Intronic
1113488894 13:110676846-110676868 TCTTCCCAAAAAATCACCCATGG + Intronic
1116621491 14:47209866-47209888 TCCTCCCAAAACATCAGCCTTGG - Intronic
1118331975 14:64822217-64822239 GCCTCCCTGAACTTGACCCAGGG - Intronic
1118487898 14:66231490-66231512 CCCTCCCCAAACTTTCCCCATGG + Intergenic
1119689515 14:76660431-76660453 GCCTCCAAAAGCTTCACCCATGG - Intergenic
1119916564 14:78407450-78407472 GCCTTCCAAAGCATAACCCCAGG - Intronic
1123105674 14:105840057-105840079 TCCTCCCAAGACATTCCCCACGG - Intergenic
1123986118 15:25647751-25647773 GCCTCCACAAACATAACACACGG + Intergenic
1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG + Intronic
1135714708 16:24752494-24752516 GCCTACCAAAACCCTAACCATGG - Intronic
1141726798 16:85794960-85794982 GCCTCCCAAACCACTTACCAGGG - Intronic
1142174793 16:88640159-88640181 GCCTCCCCCAACACTACCCTTGG + Exonic
1142769155 17:2084246-2084268 GCTTCCCCACACAGTACCCAGGG + Intronic
1144084344 17:11795215-11795237 GCCTCCCAAGGCATAATCCATGG - Intronic
1145011421 17:19370498-19370520 CCATCCCAGAACATTCCCCAAGG - Intronic
1147794624 17:43033623-43033645 GCCTCACCAAAGATTCCCCAGGG - Intergenic
1152033071 17:77855637-77855659 GCCTCCCAACACGGTACCCATGG + Intergenic
1153056850 18:954345-954367 GCTTCCTAAAACAATAACCAAGG + Intergenic
1158988435 18:62843540-62843562 GCTTACCAAAATAATACCCAAGG + Intronic
1159303904 18:66614929-66614951 TCCTCCCAAAAAATTATTCATGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1165783186 19:38445686-38445708 GCCTCCAAAATCAATACTCAAGG + Intronic
1166140971 19:40805000-40805022 GCCTCCCAACACATTATCCCAGG - Intronic
1168721231 19:58555999-58556021 GCCCCCCAAACCCCTACCCATGG + Exonic
925726858 2:6881585-6881607 GCCTCACCATACATCACCCAAGG - Intronic
926239959 2:11077868-11077890 CTCTCCCACAACACTACCCAGGG + Intergenic
929554745 2:42919065-42919087 GCCTCCCCAAGAACTACCCAGGG - Intergenic
929568750 2:43006658-43006680 GCCTCCCAAAGCTATGCCCAGGG + Intergenic
932578402 2:72976123-72976145 ACCTTCCAAAACATTACCTGTGG - Intronic
936019780 2:108986044-108986066 GTGTCACAAAGCATTACCCAAGG - Intronic
937960607 2:127455113-127455135 TCCTCCCAAACCATTCCCCTTGG - Intronic
939595292 2:144115437-144115459 GCCTCCCAAAAAATTAACTGTGG + Intronic
939644707 2:144683428-144683450 CCCACCCAAAACATTTCCCATGG + Intergenic
942389191 2:175474772-175474794 TTCTCCCAAAACTTTAGCCAAGG + Intergenic
948296329 2:236863398-236863420 GGCTCCCAAAACCTGCCCCAGGG + Intergenic
1168750393 20:277744-277766 GGCTCCCAAGACACAACCCATGG + Intronic
1172362975 20:34327105-34327127 AAATCCCAAAACATTAGCCAGGG + Intergenic
1172443313 20:34980243-34980265 CCCTCCCAAAACCCTACCTATGG + Intronic
1172852737 20:37978264-37978286 GCCTCACAAAAAATAAGCCAGGG - Intergenic
1173614624 20:44394722-44394744 GCCTCCCAACGCATAGCCCACGG - Intronic
1174510282 20:51046115-51046137 GCATCCCACAGCATCACCCAAGG + Intergenic
1184920795 22:47604421-47604443 GCCTTTTAAAATATTACCCAGGG - Intergenic
955067909 3:55548219-55548241 TCCTCCCAAAACATGCCACATGG + Intronic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
955897531 3:63716377-63716399 GCCTGCCCAAACATGACACAAGG + Intergenic
966228148 3:177620270-177620292 GCCTCCCAGAACATAAACGACGG - Intergenic
969441577 4:7220239-7220261 GCCTCCCGAGGCATTAACCAAGG + Intronic
973828065 4:54729258-54729280 GCCTCCCATAAAAATACCCAAGG - Intronic
973979792 4:56298430-56298452 ACCTCCCAATCCATTACTCAAGG - Intronic
975038479 4:69713319-69713341 GCCTAACAACACATGACCCAAGG - Intergenic
979176604 4:117672115-117672137 GCATTCCAAAACATGGCCCATGG - Intergenic
979546325 4:121944363-121944385 TCCTCCCATTACATTTCCCATGG + Intronic
982104625 4:152000623-152000645 GCCTCCCAATTCCTCACCCAGGG - Intergenic
984799795 4:183704219-183704241 GCCTCCCAAAACATTATTAATGG - Intronic
986400895 5:7378647-7378669 GGCTCCCAAAACAAAACCCCTGG + Intergenic
988445043 5:31276336-31276358 GCATGCCAAAATATTTCCCAGGG + Intronic
994660684 5:102650346-102650368 GCCTGCCACAACATGACCCTAGG - Intergenic
997437489 5:133885663-133885685 GCCTCGCACACCATTGCCCAAGG - Intergenic
1003867975 6:10380977-10380999 GCCTCCAACCACATTAGCCATGG + Intergenic
1007360983 6:41355552-41355574 CCCTACCCAGACATTACCCATGG - Intergenic
1011309361 6:85965181-85965203 GCTTCCCAAAATATTAGCAAAGG - Intergenic
1012852696 6:104466021-104466043 GTCTCCCAAAACTTTAGCCTTGG + Intergenic
1013235533 6:108195039-108195061 GACTCCCAAAACTTCCCCCAGGG + Intergenic
1013660721 6:112294060-112294082 GCTTCTCAAAAGATTCCCCATGG - Intergenic
1020743194 7:12048550-12048572 TCCTCCCAAAACATTCATCATGG + Intergenic
1029066478 7:97854563-97854585 GCCTCTAAAAATATTACCCATGG + Exonic
1032804500 7:135340978-135341000 GCCTCACAAAAGAGTAACCAAGG - Intergenic
1037582377 8:20253284-20253306 TCCGCCCACAACATCACCCAGGG - Exonic
1037710998 8:21355405-21355427 CCCTCCCCAAACAGTAGCCAAGG - Intergenic
1042344916 8:67717643-67717665 GCCTCCCAAAAGATATCCCTGGG + Intronic
1049418682 8:142507236-142507258 GCCTCCCAACACACAGCCCAGGG - Intronic
1051608469 9:18939295-18939317 GCCCCCCAACACCCTACCCATGG + Intronic
1052022607 9:23542200-23542222 GCTTCCTAAAACATGACTCACGG + Intergenic
1055018653 9:71645900-71645922 GTCCCCCAAAACCTTTCCCATGG + Intergenic
1056300610 9:85236725-85236747 GCCTCCAAAAACATTGCACATGG - Intergenic
1061509965 9:131054376-131054398 GCCTCCCAAAACATTACCCATGG - Intronic
1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG + Intergenic
1190253019 X:48741853-48741875 GCTTCCCAAAACTTTCCCAAAGG - Intergenic
1191936866 X:66436401-66436423 GCCCCCCCAAACATTTCCAAGGG + Intergenic
1192502696 X:71664176-71664198 GCCACACAAAACATTACCCGAGG + Intergenic
1192504077 X:71670329-71670351 GCCACACAAAGCATTACCCGAGG - Intergenic
1192509901 X:71715558-71715580 GCCACACAAAGCATTACCCGAGG + Exonic
1192510864 X:71719631-71719653 GCCACACAAAGCATTACCCGAGG - Intergenic
1192515833 X:71761922-71761944 GCCACACAAAGCATTACCCGAGG + Intergenic
1192516796 X:71765995-71766017 GCCACACAAAGCATTACCCGAGG - Exonic
1192529034 X:71870665-71870687 GCCACACAAAGCATTACCCAAGG + Intergenic
1192585193 X:72313646-72313668 GACTCTGAAAACTTTACCCAGGG + Intergenic
1194067259 X:89276891-89276913 GCCACCAAAAGCATTGCCCAGGG - Intergenic
1197787693 X:130216206-130216228 GGGTCCCAAAACATTTCCAATGG + Intronic
1200721419 Y:6611105-6611127 GCCACCAAAAGCATTGCCCAGGG - Intergenic