ID: 1061510057

View in Genome Browser
Species Human (GRCh38)
Location 9:131055050-131055072
Sequence GTTGTAATGGGGAAAACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061510057_1061510069 20 Left 1061510057 9:131055050-131055072 CCTCCAGTTTTCCCCATTACAAC 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1061510069 9:131055093-131055115 CCAGCCTCATAGAAAGGTCTTGG No data
1061510057_1061510067 14 Left 1061510057 9:131055050-131055072 CCTCCAGTTTTCCCCATTACAAC 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1061510067 9:131055087-131055109 TAGGGACCAGCCTCATAGAAAGG No data
1061510057_1061510064 -5 Left 1061510057 9:131055050-131055072 CCTCCAGTTTTCCCCATTACAAC 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1061510064 9:131055068-131055090 ACAACCGTGTCACAGGGAATAGG No data
1061510057_1061510065 -4 Left 1061510057 9:131055050-131055072 CCTCCAGTTTTCCCCATTACAAC 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1061510065 9:131055069-131055091 CAACCGTGTCACAGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061510057 Original CRISPR GTTGTAATGGGGAAAACTGG AGG (reversed) Intronic
904545859 1:31271273-31271295 GTTGTAATGGGGAAAGCTTTAGG - Intronic
904949953 1:34228886-34228908 CTTGAAATGGGGAAAACCTGGGG + Intergenic
904958044 1:34305005-34305027 GTTCCACTGAGGAAAACTGGAGG - Intergenic
904985409 1:34543890-34543912 TTAATAATAGGGAAAACTGGGGG + Intergenic
909198436 1:72657399-72657421 GTTGAGATGCGGAATACTGGTGG - Intergenic
911415784 1:97571536-97571558 GTTGAAAAGGAGAAAAGTGGAGG + Intronic
912375908 1:109209795-109209817 GTTGGAATGGGGAATACGAGGGG + Intergenic
913046912 1:115081538-115081560 GTTGTAGTGGATAAAAATGGGGG + Intronic
913215777 1:116619197-116619219 TTTGCACTGGGGAAGACTGGAGG - Intronic
913551647 1:119922601-119922623 GGTGTAAAGGGGAAAGGTGGCGG - Intronic
915798983 1:158768363-158768385 TTTGTGATGGGGAAGACTAGGGG - Intergenic
916969850 1:170001409-170001431 GATTTAATTGGGAAAACAGGAGG + Intronic
917694138 1:177502762-177502784 TTTGTTATGGGGAAAGCTGTGGG - Intergenic
917721251 1:177788689-177788711 TTTCTAATGGGAAAAGCTGGAGG + Intergenic
918101998 1:181384430-181384452 ATTTTATTGGGGAAAAATGGAGG + Intergenic
918616835 1:186553689-186553711 GTGGTAATGAGGATCACTGGGGG + Intergenic
919083665 1:192894968-192894990 CTTGAAATTTGGAAAACTGGTGG + Intergenic
920273966 1:204790105-204790127 GTTGGAAAGGGGAACGCTGGTGG + Intergenic
920987338 1:210902764-210902786 GTGGGAATGGAGAGAACTGGAGG - Intronic
924221761 1:241884239-241884261 GTTGTGATGGGGAAAAAGTGAGG - Intronic
1063223258 10:3990955-3990977 GATGTGTTGGTGAAAACTGGGGG - Intergenic
1065310616 10:24412918-24412940 ATTGAGATGGGGAAAACTGTGGG - Intronic
1065983992 10:30931060-30931082 CTGGGAATGGGGTAAACTGGTGG - Intronic
1068066877 10:52143214-52143236 GGTGGAATGGGGAAGGCTGGGGG - Intronic
1068138871 10:52979034-52979056 GTTATACGGGGGAAAATTGGAGG - Intergenic
1073251424 10:102122077-102122099 GTGGAGATGGGGAAACCTGGGGG - Intergenic
1074069940 10:110057143-110057165 GTTGATATGGGGAGAATTGGGGG - Intronic
1075243100 10:120795807-120795829 GTTATAAAGGAGAAAACTGAAGG + Intergenic
1080877876 11:36293050-36293072 GGTGTGATGGGGAGAATTGGGGG - Intergenic
1082131843 11:48499738-48499760 TTTTTAATGGGGACGACTGGAGG - Intergenic
1082565308 11:54670356-54670378 TTTTTAATGGGGACGACTGGAGG - Intergenic
1082973171 11:59044573-59044595 GTTAAAATGGGAAAAATTGGAGG + Intergenic
1084099073 11:66933629-66933651 GTTGTCATGGGGCCAAGTGGAGG - Intronic
1085983892 11:81760811-81760833 GTAGCAATGGGTAAAACTGTGGG + Intergenic
1086471664 11:87120037-87120059 TTTGAAATGGGGAACATTGGTGG + Intronic
1086980146 11:93187785-93187807 AAAGTAATGGGGAAAATTGGTGG - Intronic
1088582670 11:111330880-111330902 TTTGTGATGGGGAAGGCTGGTGG - Intergenic
1088671282 11:112144032-112144054 GATGTATAGGGGAAAACTAGAGG - Intronic
1089051551 11:115550030-115550052 GTGGTCAGAGGGAAAACTGGAGG - Intergenic
1093863782 12:24200003-24200025 GTTTTAAAGTGTAAAACTGGGGG + Intergenic
1095433782 12:42165216-42165238 GTTGTGATAGAGAAAACAGGAGG + Intronic
1095926600 12:47585341-47585363 GGTGTCATGGGGGAGACTGGAGG + Intergenic
1096374191 12:51094441-51094463 GTTATAATGGGTAGCACTGGTGG + Exonic
1098514906 12:71364005-71364027 GTTATAATAGGGAAGACTGTAGG + Intronic
1101440918 12:104703816-104703838 GAACTAATGGGGAAACCTGGAGG - Intronic
1101630829 12:106492769-106492791 GTTGTAAAGGGGAAGAATTGAGG - Intronic
1103325069 12:120115143-120115165 GAGGTAAGGGGGAAAGCTGGGGG - Intronic
1103834641 12:123809088-123809110 CCTGAAGTGGGGAAAACTGGGGG - Intronic
1105219508 13:18312673-18312695 TTTGCACTGGGGAAGACTGGAGG - Intergenic
1107000200 13:35535206-35535228 CCTGTAATGTAGAAAACTGGCGG + Intronic
1108283015 13:48878126-48878148 CTTGTAATAGTGAAAACTTGGGG - Intergenic
1108866760 13:54933189-54933211 TTTGTAATGTGGAATACTGAAGG + Intergenic
1110326911 13:74226956-74226978 CTTGGAGTGGGGAAGACTGGAGG - Intergenic
1111223414 13:85237181-85237203 CTAATAATGGGGAAAACTGGAGG + Intergenic
1115073127 14:29350531-29350553 CTTGTAATGTGGAGAACAGGTGG - Intergenic
1115260682 14:31449985-31450007 TTTGTAATAGAGAAAACTAGAGG - Intronic
1116141229 14:40996889-40996911 TTTGTATTGGGTAAAACTGAGGG + Intergenic
1117114552 14:52496253-52496275 GTTGAAGCGGGGAAAAATGGAGG + Intronic
1117533458 14:56681495-56681517 ATATTAATGGGGAAAACTAGCGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1125649964 15:41308439-41308461 GTTGTCCTGTGGAAAACAGGTGG - Intergenic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1127186737 15:56488218-56488240 GTTGGGATGGAGAACACTGGAGG + Intergenic
1128746205 15:70116180-70116202 TTAGTAACGGGGGAAACTGGGGG + Intergenic
1133477254 16:6135421-6135443 GTTTTAATGAGGAAGAGTGGTGG + Intronic
1134357155 16:13493062-13493084 GTTTTAAGGGGGAAAAGTGGAGG + Intergenic
1135798251 16:25466821-25466843 GTCGTAATGGGGAAAAGTGATGG + Intergenic
1137052555 16:35726252-35726274 GTTCTAATGGGAAAAACTCCTGG - Intergenic
1138363887 16:56456459-56456481 ACTGTGATGGGGAAAACTGCAGG - Intronic
1138409511 16:56827494-56827516 ATTGTAACGGAGAAATCTGGTGG + Intronic
1139160976 16:64508086-64508108 GTGGGAATGTGGAACACTGGGGG + Intergenic
1141048653 16:80740234-80740256 GTTTTAGTGGGGAAAACAAGTGG - Intronic
1145101596 17:20081798-20081820 GTTGTAATGTGGGAAACTCAGGG - Intronic
1147591665 17:41687918-41687940 GATGTAATGGGGTGGACTGGGGG - Intergenic
1150049008 17:61940329-61940351 GGTGTAATGTGGAAATCAGGTGG + Intergenic
1151025507 17:70671868-70671890 GTTGCAATGGGCTAAAATGGAGG - Intergenic
1152374133 17:79909727-79909749 TTTGTAAGGGGGAAAAATTGAGG - Intergenic
1153816611 18:8795816-8795838 GTTGTAAAGGAGAAAACAAGTGG - Intronic
1156411377 18:36830804-36830826 ATTGTACAGGGGAAAAATGGTGG + Intronic
1157497751 18:48168379-48168401 GTTATAAGGGGGAAAAGTGGTGG + Intronic
1157619516 18:49008309-49008331 GCAGTAATGGGGAGACCTGGGGG + Intergenic
1158018795 18:52815903-52815925 GTTGTAAATGTGCAAACTGGTGG - Intronic
1159452407 18:68619187-68619209 TTTATAATAGGGGAAACTGGAGG + Intergenic
1161316407 19:3619546-3619568 GCTGTGATGGGGAAGAGTGGAGG + Intronic
1163083114 19:14957682-14957704 ATTCTAATGGGGAAAGCAGGAGG + Intronic
1163536658 19:17880848-17880870 CATGTACTGGGGAGAACTGGGGG - Exonic
1163841856 19:19616255-19616277 GTTGCAATGGGGAAAAATAAAGG - Intronic
1164399705 19:27894163-27894185 GTTTTCAGGTGGAAAACTGGAGG - Intergenic
1165937014 19:39395499-39395521 GAGGAAATGGGGAAGACTGGGGG + Intronic
1167323320 19:48809689-48809711 GTTATAATGGGGAAAAGTGCTGG - Intronic
1167647844 19:50715455-50715477 GTTGTGATGGGGATAATGGGGGG + Intronic
925141603 2:1553783-1553805 GATGTAATGGGGATCACTGGAGG + Intergenic
925572077 2:5323193-5323215 GTTGAAATAGGGAAAAATGTAGG - Intergenic
926267428 2:11337392-11337414 TTTTTAATGGGCAAAAATGGAGG + Intronic
926298619 2:11586502-11586524 GTTGCAATGGGAAACCCTGGGGG + Intronic
929290218 2:40182018-40182040 GTGGCAATGGGGCCAACTGGAGG - Intronic
932937073 2:76116336-76116358 GTGGAAAAGGTGAAAACTGGTGG - Intergenic
933506846 2:83187482-83187504 GTTTCAAAGGGCAAAACTGGGGG - Intergenic
933975277 2:87504537-87504559 GTGGTCATGGGGAAGGCTGGGGG - Intergenic
934184541 2:89659845-89659867 TTTGCACTGGGGAAGACTGGAGG + Intergenic
934294823 2:91733982-91734004 TTTGCACTGGGGAAGACTGGAGG + Intergenic
936318549 2:111446276-111446298 GTGGTCATGGGGAAGGCTGGGGG + Intergenic
939527346 2:143313517-143313539 GTTTTTATGGGGGAAATTGGAGG - Intronic
941140748 2:161777918-161777940 GATGTAATGAGTAAAACTGTTGG - Intronic
941393327 2:164943614-164943636 AGGGAAATGGGGAAAACTGGAGG + Intronic
942356376 2:175116407-175116429 ACTGAGATGGGGAAAACTGGGGG + Intronic
942707482 2:178793048-178793070 GCAGGAATGGGGAAAAGTGGAGG - Intronic
943543575 2:189246803-189246825 ATCTTAGTGGGGAAAACTGGTGG + Intergenic
943934382 2:193896422-193896444 GTTGTAATGGGGAAAATTCAAGG + Intergenic
944773937 2:202942791-202942813 GTAGTGATGGGCAAAACTGTAGG - Exonic
947232769 2:227904600-227904622 GTTGTATTTGGGGAAACTAGAGG - Intronic
947288342 2:228543415-228543437 GATAGAATGGGGAAAAATGGAGG + Intergenic
947409504 2:229821229-229821251 GCTGTAATGGGTAAAACTGGTGG - Intronic
947776253 2:232712550-232712572 GCAGTGATGGGGAAAACTGCTGG - Intronic
1172361029 20:34312568-34312590 CTTGTAATGGGGAGGAGTGGGGG + Intergenic
1172785186 20:37464110-37464132 GGTGAAATGGAGAAAACAGGTGG - Intergenic
1176943523 21:14952465-14952487 ATTGTAAAGGGCAAAACTGGTGG + Intergenic
1177017174 21:15806562-15806584 GTTGAAATGGATACAACTGGCGG + Intronic
1177672393 21:24249227-24249249 GTTCTGATTGGGAAGACTGGTGG + Intergenic
1178356302 21:31912927-31912949 ATTGTAATTGGGAAATCTGAGGG + Intronic
1178710429 21:34911872-34911894 GCAGCCATGGGGAAAACTGGGGG - Intronic
1179274804 21:39882444-39882466 GCTGTACTGGGGAGGACTGGGGG + Intronic
1180236770 21:46465586-46465608 GCAGTAATAGGGAAAACTGCTGG + Intronic
1180817111 22:18797533-18797555 TTTGCACTGGGGAAGACTGGAGG - Intergenic
1181203300 22:21231878-21231900 TTTGCACTGGGGAAGACTGGAGG - Intergenic
1182747093 22:32614475-32614497 AGTGTAATGAAGAAAACTGGGGG - Intronic
1184044437 22:41963910-41963932 ATTGTAATGGGGAAAGCTGCTGG - Intergenic
1203223619 22_KI270731v1_random:63546-63568 TTTGCACTGGGGAAGACTGGAGG + Intergenic
1203267210 22_KI270734v1_random:23254-23276 TTTGCACTGGGGAAGACTGGAGG - Intergenic
949900883 3:8813973-8813995 TTTGTAATGGTGAAATCTGGGGG - Intronic
951166894 3:19493342-19493364 GTGTTCATGGGGAGAACTGGTGG + Intronic
953557206 3:43955770-43955792 GTTGTCATGGAGAAAACAGAAGG + Intergenic
958111807 3:89157600-89157622 GTTGTAAAGGGGTAACCTTGCGG + Intronic
959392865 3:105797934-105797956 GTTGTAATGGGTAAAACCAGGGG - Intronic
959967698 3:112375519-112375541 ACTGTAATAGAGAAAACTGGAGG - Intergenic
960194852 3:114753169-114753191 GAAGTAATGGGGAACACAGGAGG + Intronic
960259784 3:115553840-115553862 GTGGTAGTTGGGAAAAATGGAGG + Intergenic
960327759 3:116317682-116317704 GATGTTAAGGGGGAAACTGGGGG + Intronic
963278084 3:143352882-143352904 GTTATAATGCAGAGAACTGGTGG - Intronic
966050932 3:175617416-175617438 TCTGTGATGGGGACAACTGGAGG - Intronic
966618011 3:181932962-181932984 TTAGTAATTAGGAAAACTGGGGG + Intergenic
967439126 3:189486570-189486592 ATTGTAATGGGGCAGAGTGGAGG - Intergenic
968909478 4:3470226-3470248 CTTGTAAGGGGGAGAACAGGAGG - Intronic
973630047 4:52811707-52811729 ATTGAGATGGGGAAGACTGGGGG + Intergenic
974005077 4:56547813-56547835 GTTTTAATGTGGAAAAATGTAGG - Intronic
975997358 4:80331668-80331690 GTTGAAAGAGGGAACACTGGAGG + Intronic
976577961 4:86698286-86698308 ATTGTAATAGGAAAGACTGGGGG + Intronic
982633101 4:157857267-157857289 GTTGTTATGGGGAAAAAAAGTGG - Intergenic
983506909 4:168563121-168563143 GCTGAAATGGGAACAACTGGTGG + Intronic
986631674 5:9780081-9780103 GTAGAAAGGGGGAAAACTGATGG - Intergenic
987932653 5:24421682-24421704 GTAGTAATGGGGACATCGGGAGG + Intergenic
989821108 5:45796688-45796710 TTTGTAATGGGAACCACTGGAGG + Intergenic
990495258 5:56341016-56341038 GTAGAAATGGGAAAAATTGGTGG - Intergenic
990630965 5:57668285-57668307 GCAGAAATGGAGAAAACTGGGGG + Intergenic
993637138 5:90358431-90358453 GTGATAATGTGGACAACTGGTGG - Intergenic
994743103 5:103645714-103645736 GATGTAATTTGCAAAACTGGTGG + Intergenic
994996953 5:107076151-107076173 ATTGAAATGGGGAAAACAGAAGG - Intergenic
995381765 5:111543248-111543270 GTTGGGATGTGGAAAAGTGGTGG - Intergenic
996069256 5:119116180-119116202 GGTATAATGTAGAAAACTGGCGG + Exonic
996464414 5:123782894-123782916 GCTGAACTGGAGAAAACTGGGGG + Intergenic
1001252892 5:170162162-170162184 GCTGTGATGGGGACACCTGGAGG + Intergenic
1003267769 6:4581439-4581461 GTTTTAATGTAGAAAACTGTAGG - Intergenic
1004128777 6:12899302-12899324 GTTGTTATGGGGAATAGTGATGG + Intronic
1004244451 6:13959729-13959751 ATTAAAATGGGGAAAACTGCAGG + Intronic
1004251730 6:14028506-14028528 GTTTTGATGGGGATAACAGGAGG - Intergenic
1009338106 6:62518933-62518955 ATTGTAATGAGGAAGACTGAAGG - Intergenic
1009792804 6:68424654-68424676 GGAATAATGGGGAAAAGTGGAGG - Intergenic
1009939615 6:70275091-70275113 GTTGTAATAGCTAAGACTGGTGG + Intronic
1012875151 6:104717448-104717470 GTTTTAATAGTAAAAACTGGAGG + Intergenic
1013893465 6:115054635-115054657 GAAGTAAGGGGGAAAAGTGGGGG + Intergenic
1014476663 6:121881764-121881786 GTTGCAATGGGCAGAACTTGTGG + Intergenic
1014786398 6:125624576-125624598 TTTCTGATGTGGAAAACTGGGGG - Intergenic
1015989983 6:138929760-138929782 GTTTTAATGGGGATAAGTGGTGG + Intronic
1016029435 6:139322517-139322539 TCTATAATGGGGAAGACTGGAGG - Intergenic
1018043800 6:159948519-159948541 TTTGTAATCTGTAAAACTGGTGG + Intergenic
1022882142 7:34599097-34599119 GTTCTTACGGGAAAAACTGGGGG + Intergenic
1023923295 7:44646379-44646401 GTTGTAATGGGGCAACATAGGGG + Intronic
1026162746 7:67883916-67883938 GTTGCAGTGGGCAGAACTGGTGG + Intergenic
1027782956 7:82542354-82542376 TTTTTAAAGTGGAAAACTGGGGG - Intergenic
1030130490 7:106195485-106195507 ACTGTAATGGGGAAGGCTGGTGG - Intergenic
1030180888 7:106707964-106707986 TTTGTATTGGGGAGAACTTGGGG + Intergenic
1031535128 7:122924268-122924290 ACTGTAATGGGGATAATTGGAGG + Intergenic
1031718123 7:125134064-125134086 GCTGTAAAGGGCAAATCTGGTGG + Intergenic
1032002923 7:128276921-128276943 GAGGTTGTGGGGAAAACTGGAGG + Intergenic
1032810233 7:135406752-135406774 GTTGTAAAGGGGGAAACAGGAGG - Intronic
1033653981 7:143361609-143361631 GTTGGAAAGGGGAAGAATGGGGG + Intronic
1034786370 7:153929368-153929390 GTTGTGATTGGGAAAGCTGTGGG + Intronic
1034868148 7:154658247-154658269 TTTGTAATTTGGAAAACTGAGGG + Intronic
1036420852 8:8594153-8594175 GTTGTAATTGCAAAAACTAGAGG - Intergenic
1036915867 8:12803202-12803224 GATTTCAGGGGGAAAACTGGGGG - Intergenic
1037319752 8:17631543-17631565 GTTCTAGTGGGGAAGAGTGGTGG - Intronic
1038701177 8:29850546-29850568 ATTGTAATTGGGAAAAGAGGGGG - Intergenic
1039644307 8:39263747-39263769 GTTCTGATGGGCAAAACTGTAGG - Intronic
1045397106 8:101772111-101772133 GTTGAAATGGCAAAAACTGTAGG + Intronic
1046723346 8:117647599-117647621 GTTGTAAGGAGAAAAACTTGTGG - Intergenic
1049039964 8:140105104-140105126 GTTGGAAAGGGGAGACCTGGGGG - Intronic
1051492586 9:17683264-17683286 GTGCTCATGGGGAACACTGGGGG + Intronic
1051515069 9:17921383-17921405 TTTGGAATATGGAAAACTGGTGG - Intergenic
1052597165 9:30575232-30575254 GTTATACTGAGGACAACTGGAGG - Intergenic
1052852217 9:33385272-33385294 GCAGCAATGGGGAGAACTGGTGG - Exonic
1053367602 9:37534660-37534682 GTGTTCATGGAGAAAACTGGGGG + Intronic
1055428636 9:76220907-76220929 GTGGTGGTGGGGAAGACTGGGGG - Intronic
1055599109 9:77897074-77897096 TTTGTAATGGGGCAAAGGGGCGG - Intronic
1056838163 9:89974692-89974714 GTGGTACTGGGAAAAAGTGGGGG + Intergenic
1061081690 9:128374625-128374647 ATTGTCATGGGGAAAACATGGGG - Intronic
1061510057 9:131055050-131055072 GTTGTAATGGGGAAAACTGGAGG - Intronic
1187730565 X:22249535-22249557 GTTTGAATGGAGAAAAATGGAGG + Exonic
1188953992 X:36412925-36412947 GTTATAATGGGGAAACCAAGGGG - Intergenic
1189100151 X:38180620-38180642 GCTGAAATGGGAAACACTGGGGG - Intronic
1189138305 X:38573511-38573533 TTAGTAATAGGGAAAAATGGTGG - Intronic
1189847006 X:45147439-45147461 GTTGCTATGGGGAACACTTGAGG + Intergenic
1190161322 X:48033485-48033507 GTTGTAAGGGTGTACACTGGTGG - Intronic
1191228902 X:58078709-58078731 ATTGTAATGGGAGAAACTGCTGG + Intergenic
1191241863 X:58196242-58196264 GTTCTAATGGGAAAAACTCCTGG + Intergenic
1191652428 X:63554519-63554541 TTTACAATGGAGAAAACTGGTGG - Intergenic
1192411189 X:70934005-70934027 TTTATAATGGAGAAATCTGGTGG + Intergenic
1193488461 X:82116415-82116437 CTTGTAAGGGGGACAATTGGTGG + Intergenic
1193490772 X:82145147-82145169 GGTGTTATGGGGAGAATTGGTGG - Intergenic
1197918763 X:131565542-131565564 GATGTAAGGGGGAAAAAGGGAGG + Intergenic
1198429827 X:136554192-136554214 GTTGAAATAGGGAAAAATGGGGG + Intronic
1200097151 X:153669750-153669772 ATTGGTTTGGGGAAAACTGGAGG + Intronic