ID: 1061510840

View in Genome Browser
Species Human (GRCh38)
Location 9:131060025-131060047
Sequence TCTCCCTTCCCAAGCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061510833_1061510840 17 Left 1061510833 9:131059985-131060007 CCTTCTCAGCCAGGCTTCTCACT 0: 1
1: 0
2: 3
3: 31
4: 374
Right 1061510840 9:131060025-131060047 TCTCCCTTCCCAAGCACCCCAGG No data
1061510838_1061510840 -10 Left 1061510838 9:131060012-131060034 CCCTGGCAGCGGGTCTCCCTTCC 0: 1
1: 0
2: 1
3: 22
4: 152
Right 1061510840 9:131060025-131060047 TCTCCCTTCCCAAGCACCCCAGG No data
1061510834_1061510840 8 Left 1061510834 9:131059994-131060016 CCAGGCTTCTCACTCAGTCCCTG 0: 1
1: 0
2: 1
3: 42
4: 389
Right 1061510840 9:131060025-131060047 TCTCCCTTCCCAAGCACCCCAGG No data
1061510832_1061510840 18 Left 1061510832 9:131059984-131060006 CCCTTCTCAGCCAGGCTTCTCAC 0: 1
1: 0
2: 2
3: 37
4: 402
Right 1061510840 9:131060025-131060047 TCTCCCTTCCCAAGCACCCCAGG No data
1061510831_1061510840 19 Left 1061510831 9:131059983-131060005 CCCCTTCTCAGCCAGGCTTCTCA 0: 1
1: 0
2: 2
3: 40
4: 363
Right 1061510840 9:131060025-131060047 TCTCCCTTCCCAAGCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061510840 Original CRISPR TCTCCCTTCCCAAGCACCCC AGG Intronic
No off target data available for this crispr