ID: 1061513832

View in Genome Browser
Species Human (GRCh38)
Location 9:131077021-131077043
Sequence AGAGAAGCAGCCACTTTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061513828_1061513832 13 Left 1061513828 9:131076985-131077007 CCCTTTCACAGCCCGTCTGGCTC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1061513832 9:131077021-131077043 AGAGAAGCAGCCACTTTCCGAGG 0: 1
1: 0
2: 2
3: 10
4: 193
1061513829_1061513832 12 Left 1061513829 9:131076986-131077008 CCTTTCACAGCCCGTCTGGCTCA 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1061513832 9:131077021-131077043 AGAGAAGCAGCCACTTTCCGAGG 0: 1
1: 0
2: 2
3: 10
4: 193
1061513831_1061513832 1 Left 1061513831 9:131076997-131077019 CCGTCTGGCTCATCTGAAAGCTT 0: 1
1: 0
2: 3
3: 15
4: 195
Right 1061513832 9:131077021-131077043 AGAGAAGCAGCCACTTTCCGAGG 0: 1
1: 0
2: 2
3: 10
4: 193
1061513830_1061513832 2 Left 1061513830 9:131076996-131077018 CCCGTCTGGCTCATCTGAAAGCT 0: 1
1: 0
2: 3
3: 35
4: 325
Right 1061513832 9:131077021-131077043 AGAGAAGCAGCCACTTTCCGAGG 0: 1
1: 0
2: 2
3: 10
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061513832 Original CRISPR AGAGAAGCAGCCACTTTCCG AGG Intronic
900802520 1:4746179-4746201 GGAGATGCAGCCACCGTCCGAGG - Intronic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
900997285 1:6129470-6129492 AGACACGCAGCCACCTTCTGAGG + Intronic
901794875 1:11674408-11674430 GGAGAAGCAGCCCCTCTCCCAGG + Intergenic
902212581 1:14914301-14914323 AGAGAGGCAGACACTTGCCCAGG - Intronic
902232756 1:15037962-15037984 AGAAAAGCAGCCAGTTACGGTGG + Intronic
903913205 1:26743957-26743979 AGAGAAGCAGGGTCTTTCTGAGG + Intronic
904533613 1:31184603-31184625 AGAGGATCAGCCACTTGCCCAGG + Intronic
904843157 1:33387253-33387275 AGAGAAGCAGTGACTGTACGGGG + Intronic
905480578 1:38259170-38259192 AGAGATGCAGTCACTTGCCTGGG - Intergenic
905891985 1:41523527-41523549 AGAGAAGAGGCCACTCTCCCAGG + Intronic
907111176 1:51927926-51927948 GGACAAGAAGCCCCTTTCCGAGG + Intronic
909893657 1:81038309-81038331 AGAGAAGCAGACACCCTCCCAGG - Intergenic
910028377 1:82686520-82686542 AGAGAAGCAGCCAGGTGCAGTGG + Intergenic
910463702 1:87474571-87474593 ATATAAGCAGACACTTTCAGTGG - Intergenic
911181776 1:94867257-94867279 AGAAAAGCAGGCAGTTTCTGAGG - Intronic
911550564 1:99274467-99274489 GGAGAACCAGCCCCTTTCCAGGG - Intronic
913012249 1:114695589-114695611 AGAGAAGAATCAAATTTCCGGGG - Intronic
915635174 1:157181453-157181475 GGGGAAGCAGCTACTTTCAGTGG - Intergenic
917617190 1:176758048-176758070 AGAGAAACTTCCACTTTCCCAGG + Intronic
918184344 1:182113881-182113903 AGAGAAGCACACACCTTCCGTGG - Intergenic
918312536 1:183295287-183295309 AAAGAAGCAGCCAAGTGCCGTGG - Intronic
919790879 1:201290251-201290273 AGAGCATCTGCCACTTTCCCAGG - Intronic
923149006 1:231217523-231217545 AGAGGAGCCACCACTTTCCTGGG + Intronic
1066302771 10:34111324-34111346 GAAGAAGCAGCCTCCTTCCGAGG - Exonic
1067170554 10:43902768-43902790 AGGGAAGAATCCAGTTTCCGAGG - Intergenic
1068190814 10:53650433-53650455 AAAGAAGCAGCAACTTTGCAAGG - Intergenic
1070526767 10:77302239-77302261 AGAGAAGCAGCCCCTTTCCCAGG - Intronic
1071476074 10:86025968-86025990 AGGGGAGCAGCCACTTTCCAAGG + Intronic
1072822755 10:98574491-98574513 AGAGAAGCAGGAGCTTTCCTTGG + Intronic
1076628904 10:131841165-131841187 AGAGAAGAAGCCCCTTTCCCAGG + Intergenic
1078360491 11:10664144-10664166 CGAGACGCAGCCCCTCTCCGAGG + Intronic
1080379002 11:31747763-31747785 AGAGAAGCAGCCAAGTTCAGAGG - Intronic
1083209561 11:61174638-61174660 AAAGGAGCAGCCACCTTCGGGGG - Intergenic
1084016917 11:66389145-66389167 AGCGCAGCACCCACTTTCTGTGG - Intergenic
1084629513 11:70338063-70338085 AGAGAAGCAGACTCTTTTAGAGG - Intronic
1084711544 11:70846962-70846984 AGAGCAGCAGCCAGTCCCCGTGG - Intronic
1086402119 11:86469564-86469586 CGAGAAGCTCCCACTTACCGGGG + Intronic
1089428539 11:118401399-118401421 AGAGAAGCAGGCATTTTGTGGGG - Exonic
1089818727 11:121201494-121201516 TGAGAAGCAGCCAGTGTGCGTGG + Intergenic
1095581584 12:43806306-43806328 GGAGGAGCAGCCACTTCCTGGGG - Intronic
1099112098 12:78574381-78574403 AGAGAAGCAGAGACTGTCTGTGG + Intergenic
1099614057 12:84912641-84912663 AGAGAAGCAGCTTCTTGCCTAGG + Exonic
1100060315 12:90566796-90566818 AGAGAAAAACCCACTTTCTGGGG - Intergenic
1100376031 12:94017251-94017273 AAAGAAGAACCCACTTTCTGGGG + Intergenic
1101211659 12:102541100-102541122 AGAGCAGCAGCTACTTTACATGG + Intergenic
1103020353 12:117529010-117529032 AAAGGAGCAGCAACTTGCCGGGG - Intronic
1103067677 12:117913624-117913646 AGAGAAGCAGCCACAAGCCAAGG + Intronic
1103637952 12:122324285-122324307 AGAGAAGCAGCTTCTTTCTCAGG - Intronic
1104591075 12:130085111-130085133 AGATAAGCAGACTCTTTCCCTGG + Intergenic
1105004282 12:132711198-132711220 AGCGGAGGAGCCGCTTTCCGGGG + Intronic
1106351846 13:28937992-28938014 AGGGAAGCATCCTCATTCCGAGG - Intronic
1106589264 13:31085501-31085523 AGAGAAGCACCCACTCACCAGGG - Intergenic
1108178858 13:47821514-47821536 AGAGAAGGAGCCTCTTCCCTGGG - Intergenic
1108688039 13:52837636-52837658 AGAGAAGCAGCCAGGCTCTGTGG - Intergenic
1110430633 13:75418930-75418952 ATAGGAGCAGCCACTATCCAAGG + Intronic
1114293553 14:21308766-21308788 ATATAAGCAGCCACTTTTCCCGG - Intronic
1114646989 14:24261366-24261388 AGAGAACCAGCCACATCCTGGGG + Intronic
1116440183 14:44942137-44942159 GGAGGAGAAGCCACTTTCAGGGG - Intronic
1118645446 14:67834159-67834181 AGAGAAGCAGCCACAAGCCAAGG - Intronic
1118997441 14:70849457-70849479 AGAGAAGGAGCTAGTTTCAGAGG + Intergenic
1119660337 14:76446848-76446870 AGAGATGGAGCCACTTTCTGTGG + Intronic
1119851940 14:77872534-77872556 AGAGAGGCAGCACCTTTCCCAGG - Intronic
1121566554 14:94914460-94914482 AGAGGAGCTGCCACTTCCAGAGG + Intergenic
1122595124 14:102885174-102885196 AGAGGAGCAACCACGTTCCGAGG + Intronic
1122864916 14:104599365-104599387 AGAGGAGCAGTGACTTTCAGTGG - Intronic
1125422528 15:39518969-39518991 AAAGAAGCACCCACTTGCCTGGG + Intergenic
1125599652 15:40908205-40908227 GAAGCAGCAGCCACCTTCCGGGG - Intergenic
1125704364 15:41719980-41720002 TGAGAAGCAGCATTTTTCCGAGG - Intronic
1126310463 15:47310290-47310312 ATAAAAGCAGCCAATTTCAGAGG + Intronic
1127649967 15:60997548-60997570 TGAGAAGCAGCCATTCTCAGGGG - Intronic
1127803342 15:62496239-62496261 AGAGAAGCAGCTTATTTCCTGGG + Intronic
1127814779 15:62598363-62598385 AGAGAAGCAGCGATTTTCTGGGG - Intronic
1128211068 15:65902871-65902893 AGAGAGGCAGTGACTTTCCAGGG + Intronic
1128553649 15:68615304-68615326 AGAGAATCAGTCATTTTCCCTGG + Intronic
1129680059 15:77653679-77653701 AGACAAGTAGCAACTTCCCGAGG - Intronic
1130619329 15:85445283-85445305 AGAGATGAAGCCCCTTTCAGTGG - Intronic
1131429524 15:92375629-92375651 ACAAAAGAAGCCACTTTCAGAGG + Intergenic
1134747832 16:16601569-16601591 AAAGAAGGAGGCACTTTCCTGGG + Intergenic
1134997636 16:18752094-18752116 AAAGAAGGAGGCACTTTCCTGGG - Intergenic
1136577850 16:31134974-31134996 AGAGAAGCAGGGACTTGCCCAGG - Intronic
1141746324 16:85928926-85928948 AGAGAAGAAGTCATTTTCCAAGG - Intergenic
1143925639 17:10366859-10366881 AGAAAAGCATCCACTTCCCATGG + Intronic
1146295439 17:31646204-31646226 TTAGAATCAGCCACTTTCCCAGG - Intergenic
1146619657 17:34387580-34387602 AGTGAAGCAGGCACCTTCCTGGG - Intergenic
1149789839 17:59467377-59467399 ACAAAGGCAGCCAGTTTCCGTGG + Intergenic
1150971347 17:70031732-70031754 AGAGCAGCAGCCAGTGTCCAGGG - Intergenic
1151894017 17:76968178-76968200 ACAGAAATAGCCACTTACCGTGG - Intergenic
1152785521 17:82245997-82246019 AGACGAGCAGCTACTTGCCGTGG + Intronic
1153422690 18:4926115-4926137 AGAAAAACAGCCACTTTCAAAGG - Intergenic
1154302405 18:13205880-13205902 ATGGAAGCAGCGACTTTCCAAGG + Intergenic
1155009472 18:21761581-21761603 AGGGAAGCAGCCTCTTTAGGTGG - Intronic
1156861153 18:41837729-41837751 AGAGAAGCAGGCACATCCCATGG - Intergenic
1157423430 18:47564893-47564915 AAAGAAGCAGCCAGATTCTGTGG + Intergenic
1160106370 18:75982036-75982058 TGAGAAGCAGACACTTAGCGTGG - Intergenic
1160679630 19:406815-406837 AGAGAAGGGGCCACTTCGCGGGG - Exonic
1161075207 19:2282036-2282058 ACAGAAGCGGCCACTTTTTGAGG - Intronic
1166239795 19:41482443-41482465 AGCCAAGCAGCCTCATTCCGTGG + Intergenic
1167745757 19:51351010-51351032 AGATAAGCAGCCACTTGTCCAGG + Intronic
1168491975 19:56818582-56818604 AGAGAAGCAGCTGCTTACCGAGG + Exonic
925059643 2:881062-881084 ACAGAAGCAGTCACGTTCCAAGG + Intergenic
926286486 2:11492857-11492879 AGATAAGGAGCCATTTTCCTAGG - Intergenic
929979959 2:46669064-46669086 GGAGCAGCAGCCATTTTCTGGGG - Intergenic
931700405 2:64904419-64904441 AGAACAGCTGCCACCTTCCGAGG - Intergenic
931851460 2:66255397-66255419 AGAGAATCAGCCAAATTCCAAGG - Intergenic
933666649 2:84970661-84970683 CGAGAAGCACCCACCTCCCGCGG + Intergenic
935082160 2:99808774-99808796 AGAGAAGCAGCCCCCTGCCTTGG + Intronic
935728108 2:106041492-106041514 AGAGAAGCCACCACTTTGCCAGG + Intergenic
938266800 2:129933704-129933726 AGAGAAGGAGCCAGGATCCGGGG - Intergenic
939614677 2:144349056-144349078 AGAGAAGGTGCCACATTCCAGGG + Intergenic
942314334 2:174683482-174683504 GGAGAGGCAGCATCTTTCCGAGG - Intergenic
942727124 2:179022442-179022464 AGAAAAGCTGCCTCTTTCCTCGG - Intronic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
948988357 2:241539783-241539805 AGAGAAGCACCCCCTTCCAGGGG + Intergenic
1168936003 20:1665550-1665572 AAAGAAGGAGCCTCTTTCCCTGG - Intergenic
1169949426 20:11026903-11026925 AGAGGTGCAGCCACCTTCCCGGG - Intergenic
1172610369 20:36246573-36246595 AGGGAAGCAGCCACTGCCAGAGG - Intronic
1172767042 20:37356464-37356486 AGAGAAGCAGGCACTGGCAGGGG + Intronic
1174358598 20:50014452-50014474 AGACCAGCAGCCACTGGCCGAGG - Intergenic
1175732163 20:61361491-61361513 AGACAACCAGACACTTTCCTTGG + Intronic
1178453613 21:32727603-32727625 CGAGAAGGAGCCGCTTTCCCGGG - Intronic
1179889498 21:44328444-44328466 AGGGAGGCAGCCACTGTCCCGGG - Intergenic
1180036870 21:45254655-45254677 ACAGAAGAAGCCACTTGCTGAGG + Intergenic
1181559187 22:23690078-23690100 AGAGAAGCAGCTACCTTCAGAGG - Intronic
1182782595 22:32880236-32880258 AGAGAAGTAGCTACTTTACAGGG - Intronic
950045035 3:9944000-9944022 AGAGATGAAGCTACTTTCCCAGG + Exonic
952763287 3:36934266-36934288 TGAGAAGAAGCCAATTTCTGGGG + Intronic
953276046 3:41499432-41499454 AAAGAAGCTGCCACTTTGCCAGG - Intronic
955484805 3:59424573-59424595 TGAGACGCAGCCACATTGCGTGG - Intergenic
962166588 3:133055634-133055656 AGAGGAGCTGCCTCTTTCTGTGG - Intronic
963146634 3:142001277-142001299 AGAGGAGCAGCCACTATACTTGG + Intronic
964023609 3:152044362-152044384 AGAGAAACAGCCATTTTTAGAGG - Intergenic
964720449 3:159764070-159764092 CGAGAACCAGACACTTTCCCAGG - Intronic
965711812 3:171563322-171563344 ACAGAAGCAGGCTCTGTCCGTGG - Intergenic
966481134 3:180410547-180410569 AGAGAAGCAGCAACACTCCAGGG - Intergenic
968096203 3:195932487-195932509 GGAGAAGGAGCCTCTTTCTGTGG - Intergenic
968281782 3:197482632-197482654 AGAAAATCAGTCACTTCCCGAGG - Intergenic
968311585 3:197687988-197688010 AGAGGAGCAGTCACTATCCCTGG - Intronic
969503780 4:7570981-7571003 AGAGGCGCAGCCACTCTCCAAGG + Intronic
969992193 4:11276105-11276127 ATAGAAGCTACCACTTCCCGTGG - Intergenic
970121764 4:12761836-12761858 TGAGAAGCAGCCACCTTCACAGG + Intergenic
970886150 4:20989633-20989655 AGAGGAGCAGTGACTTTCCCAGG + Intronic
973884395 4:55306084-55306106 AGAAAAGGACCCACTTTCCCTGG + Intergenic
979996984 4:127443132-127443154 ATAAAAACAGCCACTTTCTGAGG + Intergenic
981018283 4:139998717-139998739 ACAGAAGCAACAACTTTCAGGGG - Intronic
985470342 5:38297-38319 AGAGAAGAAGGCAGTTTCCCAGG - Intergenic
985958761 5:3283903-3283925 AGACAAGCAGGTACTTTCCTTGG - Intergenic
990855284 5:60259886-60259908 GCAGAAGTAGCCACTTTCCTTGG - Intronic
991297180 5:65093666-65093688 AGAGAAGCAGGCAGTCTCCTGGG + Intergenic
992568912 5:78031511-78031533 AGAGAATGAGCCACTTGCCTGGG - Intronic
995647716 5:114331312-114331334 AGAGCAGCAACCCCTTCCCGTGG - Intergenic
995832815 5:116372706-116372728 AGAGAAGGAACTACTTTCCCAGG - Intronic
997300250 5:132798411-132798433 AGAGAAGGAGCCCTTTTCCTTGG - Intronic
997359073 5:133282857-133282879 AGAGCAGAAGCCCCTTTCCCAGG + Intronic
998665568 5:144293298-144293320 AGGGAAGCAGCTAATTTCAGAGG - Intronic
1001325678 5:170722060-170722082 AAAGCAGCAGCAACTTTCCCTGG + Intronic
1001859447 5:175040749-175040771 AGAGAAGCAACAATTTTCAGAGG + Intergenic
1007103960 6:39270776-39270798 AGGGTAGCAGTCACTTTGCGGGG + Intergenic
1010816354 6:80362164-80362186 AAATAAGCAGCCGCTTTCCCAGG - Intergenic
1010921917 6:81692512-81692534 AGAGAAGCAGTGGCTTTCAGTGG - Intronic
1011273518 6:85604261-85604283 ACAGCAGGAGCCACTTTCCATGG + Intronic
1012259760 6:97073958-97073980 AGACAAGCAGCCACTTCCTAGGG - Intronic
1013852823 6:114536044-114536066 AGAGAAGCAGCACCTTTCATTGG - Intergenic
1014567747 6:122971497-122971519 AGAAAAGCAGGCACTTACAGTGG + Intergenic
1016175171 6:141071318-141071340 AGAGAAAAACCCACTTTCTGGGG + Intergenic
1017442578 6:154477606-154477628 AGAGAAGCAGCCAGACACCGTGG - Intronic
1017521384 6:155206191-155206213 AGGGAGGCAGGCATTTTCCGTGG + Intronic
1018923070 6:168189202-168189224 AGGGAAGAAGTCACTTTCCCTGG + Intergenic
1019633770 7:2064593-2064615 GGAGAAGCTGCCACATTCCCGGG - Intronic
1020832158 7:13106057-13106079 ATAAAAGCAGCCACTTTCCAGGG + Intergenic
1021549782 7:21858596-21858618 AAAGAAGCAGCCAGATACCGAGG + Intronic
1022734300 7:33062197-33062219 AGAGAAGGAGCCACCTGCCCAGG + Intronic
1025927437 7:65971053-65971075 AGAGGAGCAGCCACTCTTCCAGG + Intronic
1027346979 7:77270922-77270944 AGGAAAACAGCCACTTTCCCAGG + Intronic
1028978820 7:96944338-96944360 AGAAAAGCAGCAATTTTCTGTGG - Intergenic
1031546779 7:123060704-123060726 AGAGAAGCAGTGAATTTCAGTGG - Intergenic
1035475393 7:159140473-159140495 AGAGAAGCAGCAGCATGCCGGGG - Intronic
1035827624 8:2661363-2661385 AGAGAGGCAGCCACTGCCTGAGG + Intergenic
1036630713 8:10512705-10512727 AGAGAGGCAGGCAATTTCCTCGG + Intergenic
1037750846 8:21681295-21681317 AGAGAAGAAACCATTTTCCAAGG + Intergenic
1039573699 8:38606478-38606500 AGAGAAGCAACGACTCTCCCCGG + Intergenic
1040300902 8:46187509-46187531 TGAGAAGCAGCGACTTTGCAGGG - Intergenic
1040707557 8:50147897-50147919 AGAGAATCAGCCATTTTTCCAGG - Intronic
1041263063 8:56038379-56038401 AGAGAAGCAGCCTCACTCAGTGG - Intergenic
1043404431 8:79916141-79916163 AGAGAAACAGCCAGTTTGGGTGG + Intergenic
1047050347 8:121104753-121104775 AGAGAAACAGTTACTTCCCGTGG - Intergenic
1050669691 9:7982025-7982047 AGTGCAGCAGCCACCTTGCGTGG + Intergenic
1051725870 9:20088102-20088124 AGAGTTGCAGCCACTTTTCCTGG - Intergenic
1056415039 9:86367461-86367483 AGAGAACCAGACACTATCCCTGG + Intergenic
1057298193 9:93861349-93861371 AGAGCCCCAGGCACTTTCCGCGG - Intergenic
1057393149 9:94655855-94655877 AGCGAAGCAGCCACATGCTGAGG + Intergenic
1057839620 9:98475285-98475307 AGAAAAGCAGGCAGTCTCCGGGG + Intronic
1059492510 9:114680712-114680734 AGAGAAGCTCCCACATTCCTAGG + Intergenic
1060282470 9:122223589-122223611 AGAGAAGCAGCAACTTGCGAAGG + Intronic
1061418933 9:130462898-130462920 AGAGGTGCAGCCACTTGCCCAGG - Intronic
1061513832 9:131077021-131077043 AGAGAAGCAGCCACTTTCCGAGG + Intronic
1061514340 9:131079933-131079955 AGAGAAGCGGCCACTTTCCAAGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062495910 9:136831616-136831638 TGAGAAGCAGCCACCATCCTCGG + Intronic
1062569918 9:137180300-137180322 AGAGGAGCAGCCACCGTTCGGGG - Exonic
1186369982 X:8937047-8937069 AAGGCAGCAGCCCCTTTCCGGGG - Intergenic
1186701030 X:12090313-12090335 AGGGGAGCAGGCACTTTACGTGG - Intergenic
1190656110 X:52613529-52613551 AGTGTAGCAGCCATTTTCAGTGG + Intergenic
1199224936 X:145362583-145362605 AGAACAGCAGCCACTTTAAGAGG + Intergenic
1199928369 X:152493717-152493739 AGAGAAGAACCCATTTTCTGGGG + Intergenic
1200148762 X:153941403-153941425 AGAGAAGCAACCACCTCCCTGGG + Intronic