ID: 1061515467

View in Genome Browser
Species Human (GRCh38)
Location 9:131087522-131087544
Sequence CGTCTGGCTGGTGAGCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061515467_1061515470 -4 Left 1061515467 9:131087522-131087544 CCAGCAGGCTCACCAGCCAGACG 0: 1
1: 0
2: 3
3: 7
4: 177
Right 1061515470 9:131087541-131087563 GACGCAAGCCACGCTCCAACAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1061515467_1061515474 14 Left 1061515467 9:131087522-131087544 CCAGCAGGCTCACCAGCCAGACG 0: 1
1: 0
2: 3
3: 7
4: 177
Right 1061515474 9:131087559-131087581 ACAGGCGTCCCAGCAGGTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 203
1061515467_1061515472 8 Left 1061515467 9:131087522-131087544 CCAGCAGGCTCACCAGCCAGACG 0: 1
1: 0
2: 3
3: 7
4: 177
Right 1061515472 9:131087553-131087575 GCTCCAACAGGCGTCCCAGCAGG 0: 1
1: 0
2: 1
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061515467 Original CRISPR CGTCTGGCTGGTGAGCCTGC TGG (reversed) Exonic
900149271 1:1171143-1171165 TGCCTGGCTGGGGAGCCTGGGGG + Intergenic
900420914 1:2555571-2555593 CGTCTGGCAGATGGGCTTGCTGG + Intergenic
900421363 1:2557311-2557333 TGTCTGGCTTGTGAGCCTCTGGG + Intronic
900538898 1:3193016-3193038 CGTCTGGCCGCTGTGACTGCTGG - Intronic
900538911 1:3193109-3193131 CGTCTGGCCGCTGTGTCTGCTGG - Intronic
901002087 1:6153995-6154017 CGTCTGGGTGGGGAGGATGCAGG - Intronic
901409350 1:9071823-9071845 CCTCTGCCTGGCGGGCCTGCGGG + Intronic
901735915 1:11312096-11312118 CCTCAGCCTGGTGAGCCTGTGGG + Intergenic
903067777 1:20710410-20710432 CCTCTGGGCTGTGAGCCTGCGGG - Intronic
904283987 1:29442398-29442420 AGTCTGGCTCCAGAGCCTGCGGG + Intergenic
905448571 1:38043296-38043318 AGTTTGGGTGGAGAGCCTGCTGG + Intergenic
905873144 1:41416319-41416341 TGTCTGGCTGAGGAACCTGCTGG + Intergenic
907416109 1:54315043-54315065 TGTCTGCCTGGAGAGGCTGCTGG + Intronic
908238364 1:62168764-62168786 CTTCTGGGTCTTGAGCCTGCTGG - Intergenic
911517344 1:98882567-98882589 CATATGGCTGGGGAGGCTGCAGG - Intergenic
912421156 1:109543265-109543287 CCTCTGCCTGGTGGACCTGCTGG + Exonic
916052365 1:161045445-161045467 CTTCTGGTTGGTGAGCCTGCAGG - Intronic
917520154 1:175741739-175741761 CCTCTGGCTGGGGAGCCTTCTGG - Intronic
918179032 1:182070125-182070147 AGCCAGGCTGGTGAGCCTTCAGG - Intergenic
920293843 1:204943806-204943828 CTTCTGGTTGCTGGGCCTGCAGG + Intronic
922176115 1:223199305-223199327 AGTCTGGCTGCTGAAGCTGCTGG - Intergenic
922729441 1:227942170-227942192 CGTCTGGTTGGGGAGACAGCTGG - Intronic
1066369385 10:34807138-34807160 CTCCTGGCTGCTGAGCCTCCAGG - Intronic
1067436937 10:46284910-46284932 CCTCTGGCTCCTGGGCCTGCCGG + Intergenic
1069589628 10:69633870-69633892 AGAATGGCTGGTGAGGCTGCAGG + Intergenic
1072008722 10:91285199-91285221 CGTGTGGCTGGGGAACATGCAGG + Intergenic
1076626619 10:131824886-131824908 CCCCTGGGTGGTGAGCCTGTGGG - Intergenic
1076769391 10:132654821-132654843 CGCCTGGCGCGTGAGCCTGTGGG + Intronic
1077008038 11:368450-368472 CCCCTGGCAGCTGAGCCTGCAGG + Intergenic
1077338497 11:2015908-2015930 CCTCTGTCTGGTCAGGCTGCTGG - Intergenic
1078937244 11:15962920-15962942 TGTCTGTGTGGGGAGCCTGCTGG + Intergenic
1082127753 11:48453198-48453220 CATCTGGCTGGTGACCCTCTGGG - Intergenic
1082561308 11:54624127-54624149 CATCTGGCTGGTGACCCTCTGGG - Intergenic
1083719560 11:64597692-64597714 CGTCTGGCTGAAGGACCTGCAGG + Intronic
1084064587 11:66696345-66696367 GAGCTGGCTGGAGAGCCTGCAGG - Exonic
1084430089 11:69106257-69106279 CCTCTGGACGGTGAGCCTGGAGG + Intergenic
1084764511 11:71299469-71299491 CCTCTGGCTGGCGTTCCTGCTGG - Intergenic
1088717878 11:112564833-112564855 GGTCTGATTGGTGAGGCTGCAGG + Intergenic
1089541152 11:119189641-119189663 CTGCTGGCAGGTGGGCCTGCAGG - Exonic
1089737688 11:120561403-120561425 GGCCTTGCTGGTGAGCGTGCAGG - Intronic
1202821481 11_KI270721v1_random:71090-71112 CCTCTGTCTGGTCAGGCTGCTGG - Intergenic
1092794015 12:12092755-12092777 CGTCTGGGTTGTGACTCTGCAGG - Intronic
1093795400 12:23304207-23304229 TTTCTGGCTGGTGAGCCTTATGG - Intergenic
1101254776 12:102966197-102966219 CCTCTGACTGCTGACCCTGCAGG - Intergenic
1102339243 12:112108679-112108701 CGTCGGGCTGGCGAGCGGGCTGG + Intronic
1103907281 12:124334381-124334403 CCTCTTGCTGGTCAGCCGGCGGG - Intronic
1104811320 12:131621960-131621982 CCTCTGGCAGGAGAGGCTGCAGG + Intergenic
1107444374 13:40457256-40457278 GGTCTTGCTGGTGTGCCTGAGGG - Intergenic
1110924908 13:81138751-81138773 GGTCTGACTGGGGACCCTGCTGG + Intergenic
1113891621 13:113738729-113738751 GGTCTTGCTGGTGGGCCTGGGGG - Intergenic
1115997785 14:39211809-39211831 CGCCTTGCTGCTCAGCCTGCTGG + Intergenic
1116827649 14:49688065-49688087 CGTCTGCCTGGTGCGGCAGCGGG - Intronic
1117978556 14:61321204-61321226 CGGTGGGCTGGTGACCCTGCAGG - Intronic
1119799271 14:77428324-77428346 TGTCTGTCTCCTGAGCCTGCTGG + Intronic
1121178202 14:91906739-91906761 GGTCTGGCAGGTCAGCCAGCTGG - Intronic
1122414264 14:101541282-101541304 CAGCTGGCTGGTGAGGCAGCGGG + Intergenic
1123034514 14:105466471-105466493 CGTCAGGCTGCTGAGCACGCTGG - Exonic
1123941135 15:25217206-25217228 CCTCTAGATGGTGAGCCTGGAGG + Intergenic
1129845907 15:78767639-78767661 CCCCCTGCTGGTGAGCCTGCAGG - Intronic
1132589909 16:722074-722096 CTTCCGGCAGGTGAGCCTGAGGG + Exonic
1132896200 16:2230501-2230523 CTGCTGCCTGGGGAGCCTGCTGG + Intronic
1135115143 16:19717852-19717874 CGTCCTGCTGGTGATCCTGCCGG - Exonic
1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG + Intergenic
1137747763 16:50835588-50835610 TGGTTGCCTGGTGAGCCTGCAGG - Intergenic
1139923861 16:70475113-70475135 AGTCTGGCTGAGGAGCCTGAAGG + Intronic
1142256514 16:89016387-89016409 CATCTGGCTGTTGACCGTGCTGG - Intergenic
1142256526 16:89016514-89016536 CATCTGGCTGTTGACCGTGCTGG - Intergenic
1142309067 16:89301672-89301694 CGTCTGCCTGGACAGCCTCCAGG + Intronic
1203079453 16_KI270728v1_random:1139645-1139667 CGTGAGGGTGGTGGGCCTGCGGG - Intergenic
1143138017 17:4722898-4722920 CTTCTGGCTGCTGAGCCAGATGG + Intergenic
1143670393 17:8392498-8392520 CTCAGGGCTGGTGAGCCTGCAGG + Exonic
1144676528 17:17165794-17165816 CGTGAGGCTGGAGAGCCAGCAGG + Intronic
1147193438 17:38749807-38749829 CGTCCCGCTGGTGTGGCTGCAGG - Exonic
1147711910 17:42473310-42473332 CGTCTGGGCAGTGAGCATGCTGG - Intronic
1148271837 17:46267366-46267388 CATCTGGCTGGTGACCCTGCTGG + Intergenic
1148356278 17:46978032-46978054 CGCCTGGCTGGGGAGCCCACAGG - Intronic
1150675679 17:67244841-67244863 CGCCTGGCCCGGGAGCCTGCGGG - Intronic
1150764539 17:67993170-67993192 CATCCGGCTGGTGACCCTGCTGG - Exonic
1151404865 17:73879731-73879753 CATGGGGCTTGTGAGCCTGCAGG - Intergenic
1152457728 17:80425764-80425786 CATCTTGCTGGAGAGCTTGCTGG + Intronic
1152587796 17:81196811-81196833 GGTCTCGCTGCTGCGCCTGCAGG + Exonic
1152713924 17:81889169-81889191 CCTCTGGATGGTGAGTCTGGGGG - Exonic
1156006352 18:32446983-32447005 CCTGTGGCAGTTGAGCCTGCTGG - Intronic
1161576783 19:5058787-5058809 CGTGTCGCTTGTGAGGCTGCAGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162644117 19:12036078-12036100 CGGCTGGCGGGCGAGCCAGCGGG - Intronic
1166300647 19:41910347-41910369 CCTCTGGATGCTGAGCCTGGGGG - Intronic
1168336975 19:55602454-55602476 CTTCTGCCCGGTGTGCCTGCGGG + Exonic
1168354897 19:55694913-55694935 GGACTCGCTGGTGAGCCGGCCGG + Exonic
1168519198 19:57035203-57035225 TGTCTGGCTGCAGAGCCTGAGGG - Intergenic
925118457 2:1399287-1399309 CGTCAGGCTGCTGATGCTGCTGG - Intronic
925447480 2:3940574-3940596 ACTCTGGCTGGAGATCCTGCAGG + Intergenic
926581130 2:14633658-14633680 AGGCTGGCTGGAGAGCTTGCGGG - Intronic
927478604 2:23433094-23433116 CGTCTGGCCGGTGCCCCTTCTGG + Intronic
936038362 2:109129873-109129895 CATCTTGCTGGTGCGACTGCTGG + Exonic
946475962 2:220006476-220006498 CTGCTGGCTGGAGAGCCAGCGGG - Intergenic
948385145 2:237576275-237576297 CGTCTGTCTGGGGAGCTGGCTGG - Intronic
1168972788 20:1942264-1942286 CGGCTGGCTGGTGAGCAGCCAGG - Intergenic
1173000509 20:39102132-39102154 AGTCTGGCTGTTGAGCAGGCTGG - Intergenic
1175332956 20:58177429-58177451 CGTCTGGCTGGTGACCTTTTGGG - Intergenic
1175872838 20:62216558-62216580 CGCCTGGCTGCTGGGGCTGCTGG - Exonic
1175893261 20:62324610-62324632 GGTCTGACTTGTGAGCTTGCAGG - Intronic
1179643512 21:42761858-42761880 TGTCTGTCTGGTGGGACTGCAGG + Intronic
1180055948 21:45359289-45359311 TTTCTGGCTGGTGAGCATGAGGG - Intergenic
1180910656 22:19447652-19447674 CGGCTGGCAGGTGAGTGTGCTGG - Exonic
1181472604 22:23150145-23150167 GGACTGTCGGGTGAGCCTGCAGG + Exonic
1182454084 22:30438743-30438765 GGTAGGGCTGGTGAACCTGCAGG - Intergenic
1184768890 22:46586688-46586710 CGACTGGCTGCTGTCCCTGCTGG + Intronic
1184813878 22:46855716-46855738 CGTGTGGGTTGTGAGCCAGCCGG + Intronic
949886921 3:8702708-8702730 TGACTGGCTTGTGATCCTGCTGG + Intronic
950349020 3:12328573-12328595 GGTCTGGCTGGTGTGCCTAGTGG - Intronic
950507651 3:13405348-13405370 CTTCTGGGTCTTGAGCCTGCTGG + Intronic
951324384 3:21285116-21285138 CGTCTGGCAGGTGACCCTCTGGG - Intergenic
952178670 3:30894703-30894725 CGGCTGCCTGGTGCACCTGCGGG - Exonic
954139085 3:48595732-48595754 CATCTGTCTGGTGGGCCTCCTGG + Intergenic
954296246 3:49675973-49675995 CATCTGGCTGGTGAGCAGGCAGG + Intronic
954914777 3:54139347-54139369 CGTGAGTCTGCTGAGCCTGCTGG - Intronic
959002541 3:100981522-100981544 AGTCTGTCTGGTCAGTCTGCAGG - Intronic
959627018 3:108464122-108464144 CTTCTGGCTGGTGACTCTGGTGG - Intronic
959781530 3:110239938-110239960 CTTCAGGCTGGTGATCCTGGAGG + Intergenic
961338723 3:126202913-126202935 CCTCTGGCTGCCCAGCCTGCAGG - Intergenic
961601683 3:128067118-128067140 CAACTTGCTGGTCAGCCTGCTGG + Exonic
962315111 3:134354371-134354393 CTTCTGGCTAGTGTCCCTGCAGG - Intergenic
968592093 4:1464373-1464395 CCTCTGGCTGGTCAGCGCGCCGG + Intergenic
968628406 4:1638139-1638161 CCTCAGGCAGGTGACCCTGCAGG + Intronic
969430963 4:7154089-7154111 AGTGTGGATGGTGAGGCTGCAGG + Intergenic
969584767 4:8085266-8085288 CGTCTGCCTGGCCAGCTTGCTGG - Intronic
970121689 4:12760736-12760758 GGTCTGGCTGTTGAGCATCCTGG + Intergenic
971866917 4:32184332-32184354 GGTCTGACTCCTGAGCCTGCAGG - Intergenic
972393316 4:38633812-38633834 CCTCTGGCTGGTGGGCCTTCTGG - Intergenic
977754177 4:100646836-100646858 GGCCAGGCTGGTGAGCCTCCTGG - Intronic
985079664 4:186252078-186252100 GCCCTGGCAGGTGAGCCTGCAGG + Exonic
987546948 5:19322861-19322883 CTTCTGGGTGGTGACCTTGCTGG + Intergenic
997347134 5:133200151-133200173 TGTCTGGATGGTGAGCATGGAGG + Intronic
997453973 5:134004474-134004496 GGCCTGGCTGGTGAGCGGGCGGG - Intronic
1002323228 5:178388066-178388088 GCTCTGGCAGGTGAGCCTACTGG - Intronic
1002687428 5:181024655-181024677 TGTTTGGCTGGTGAGCATGGTGG - Intergenic
1002687458 5:181024809-181024831 TGCCTGGCTGGTGAACATGCTGG - Intergenic
1002843756 6:927491-927513 CCGCTGGCTGGAGAGACTGCAGG + Intergenic
1003052903 6:2796184-2796206 CGTGGGGCTGGTGGTCCTGCGGG - Intergenic
1003395137 6:5746599-5746621 GATTTGGCTGGTGAGACTGCGGG + Intronic
1005688723 6:28281469-28281491 CGTCTCTCTGGTGAGCCGGGAGG - Exonic
1014833507 6:126130451-126130473 GTTCTGGCTGGGCAGCCTGCTGG - Intergenic
1014894749 6:126888503-126888525 GGTCTGGGTGATGAGGCTGCAGG - Intergenic
1016474170 6:144408296-144408318 CCTCTGGCTTGTTAGCCGGCCGG + Intronic
1016589750 6:145731174-145731196 TGTGTGGCTGGGGAGCCAGCAGG - Intronic
1018308662 6:162485853-162485875 AGTCTGGCTGGAGAACCTGAAGG + Intronic
1019135389 6:169904639-169904661 CGCCTGCCTGGTGCCCCTGCAGG - Intergenic
1019328209 7:449841-449863 CTTCTGGCTGGTGCTCCTGGGGG - Intergenic
1019455228 7:1123359-1123381 CGTCCGTCTGGGGAGCCTGCGGG - Intronic
1019736449 7:2652324-2652346 CGCCTGGCTCCTCAGCCTGCAGG + Intronic
1021017113 7:15548683-15548705 CGTCTGATTGGTGTGCCTGAAGG + Intronic
1021474634 7:21046961-21046983 CGACTGGCTGGAAAGCCTGTAGG + Intergenic
1022964481 7:35459717-35459739 GTTCTGGCTGGTGAGACTTCAGG - Intergenic
1024485696 7:49916296-49916318 CCTGTGGCTGGTGAGACTTCTGG + Exonic
1026738897 7:72966133-72966155 GGCTTGGCAGGTGAGCCTGCTGG - Exonic
1027104836 7:75398936-75398958 GGCTTGGCAGGTGAGCCTGCTGG + Exonic
1028877127 7:95836592-95836614 CGTCTGACTGGTGTACCTGAAGG - Intronic
1030411115 7:109181820-109181842 CGCATGGCTGCTGAGGCTGCAGG + Intergenic
1031255353 7:119440498-119440520 CATCTGGCTGGGGAGGCTTCAGG + Intergenic
1031988418 7:128178873-128178895 CCTGGGGCAGGTGAGCCTGCTGG - Intergenic
1032460351 7:132105627-132105649 TGTCTGTCTGGTGAGCCCACTGG - Intergenic
1033793560 7:144820723-144820745 AGTCTGGCTGCAGAGCCTGTTGG - Intronic
1034676734 7:152897581-152897603 CCTCTGGCTGTGGAGCCTGTTGG - Intergenic
1035422367 7:158740298-158740320 TGTCAGGCTGGCCAGCCTGCAGG + Intronic
1036684747 8:10902234-10902256 CATCTGACTGGGGAGTCTGCTGG + Intronic
1037550077 8:19962210-19962232 AGTCAGGCTGGTGAGCATTCTGG + Exonic
1044374998 8:91459998-91460020 CCTCTGGCTGGTGGGGCTGGAGG + Intergenic
1047779493 8:128099949-128099971 CGGCTGGCTGGGGAACCTGAGGG - Intergenic
1049205119 8:141360067-141360089 AGCGTTGCTGGTGAGCCTGCTGG - Intronic
1049621259 8:143599328-143599350 CTGCTGGCTGCTGGGCCTGCGGG + Exonic
1053295400 9:36909499-36909521 AGGCTGGCTGGAGAGCCTGTGGG + Intronic
1056431398 9:86531873-86531895 CTTCTTGCTGGTGGGCCTGGAGG + Intergenic
1056752610 9:89363237-89363259 CGTCTTGTTGCTGAGACTGCAGG - Intronic
1059414578 9:114155249-114155271 CTTCTGACTGGTGAGGCTGGGGG - Intergenic
1060109623 9:120897233-120897255 CAGCTGGCTGGGGAGCTTGCTGG - Intergenic
1060342401 9:122789043-122789065 TGTCTACCTGGTGAGCCTGCTGG + Exonic
1060870518 9:127036196-127036218 CGACTGGCTGATGGGCCAGCAGG - Intronic
1060965396 9:127709703-127709725 GGACTGGCTGGTGAGCCTGCAGG + Intronic
1061424608 9:130491220-130491242 CGCCGGGCTGGAAAGCCTGCAGG - Intronic
1061515467 9:131087522-131087544 CGTCTGGCTGGTGAGCCTGCTGG - Exonic
1061849034 9:133403806-133403828 CTTCTGGCTGCTGTCCCTGCTGG + Exonic
1062467021 9:136686030-136686052 CGTCTGGCTGAGCAGCCAGCAGG + Intronic
1186292902 X:8119784-8119806 AGTCTGGCTGTTGCCCCTGCTGG + Intergenic
1188570573 X:31580360-31580382 GCTCGGGCTGGTTAGCCTGCTGG + Intronic
1191915543 X:66197908-66197930 TATCTGGCTGGAAAGCCTGCTGG + Intronic
1192392614 X:70746417-70746439 CCTCTGCCTGATGAGCCAGCTGG - Intronic
1196122810 X:112068604-112068626 CTTCTGGCTGGTGAGCATCAGGG + Intronic