ID: 1061516720

View in Genome Browser
Species Human (GRCh38)
Location 9:131094405-131094427
Sequence GATTTTACAGTTTTCTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 385}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061516720_1061516727 -7 Left 1061516720 9:131094405-131094427 CCTCCACAGAAAACTGTAAAATC 0: 1
1: 1
2: 2
3: 30
4: 385
Right 1061516727 9:131094421-131094443 TAAAATCAAGGCTACGGTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1061516720_1061516724 -10 Left 1061516720 9:131094405-131094427 CCTCCACAGAAAACTGTAAAATC 0: 1
1: 1
2: 2
3: 30
4: 385
Right 1061516724 9:131094418-131094440 CTGTAAAATCAAGGCTACGGTGG 0: 1
1: 0
2: 1
3: 4
4: 101
1061516720_1061516725 -9 Left 1061516720 9:131094405-131094427 CCTCCACAGAAAACTGTAAAATC 0: 1
1: 1
2: 2
3: 30
4: 385
Right 1061516725 9:131094419-131094441 TGTAAAATCAAGGCTACGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1061516720_1061516729 28 Left 1061516720 9:131094405-131094427 CCTCCACAGAAAACTGTAAAATC 0: 1
1: 1
2: 2
3: 30
4: 385
Right 1061516729 9:131094456-131094478 AAACTGAGCTAGGAGTGACTTGG 0: 1
1: 0
2: 2
3: 10
4: 162
1061516720_1061516726 -8 Left 1061516720 9:131094405-131094427 CCTCCACAGAAAACTGTAAAATC 0: 1
1: 1
2: 2
3: 30
4: 385
Right 1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1061516720_1061516728 18 Left 1061516720 9:131094405-131094427 CCTCCACAGAAAACTGTAAAATC 0: 1
1: 1
2: 2
3: 30
4: 385
Right 1061516728 9:131094446-131094468 TGACATGATTAAACTGAGCTAGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061516720 Original CRISPR GATTTTACAGTTTTCTGTGG AGG (reversed) Intronic
905195399 1:36272508-36272530 TATTTTACTCTTTTCTCTGGAGG - Intronic
909020891 1:70429597-70429619 TACTTTACATTTTTCTTTGGTGG + Intronic
909179968 1:72411147-72411169 GATTTTATGGTTTTCAGTGTAGG - Intergenic
909211014 1:72823518-72823540 AATTTTACCTTTTTCTGTGCTGG - Intergenic
909403611 1:75261368-75261390 GTGTTTACAGTATTCTCTGGTGG - Intronic
909491728 1:76233909-76233931 GATATTAAAATTTTATGTGGGGG + Intronic
910091663 1:83471689-83471711 GATGTTACTGTTTCCTGTGCTGG - Intergenic
910661223 1:89675279-89675301 GAATTTACAGTTTTCTGAAAAGG - Intronic
911561644 1:99413675-99413697 GAGTTGACAATTTTCTTTGGTGG - Intergenic
912086826 1:106017045-106017067 GATTTGATAATTTTCTATGGTGG + Intergenic
913239887 1:116820708-116820730 GATTTTGTATTTTTCTGTGAGGG - Intergenic
913295999 1:117321017-117321039 GGTTTTACGGTTTTCTCTGGGGG - Intergenic
913658770 1:120988430-120988452 GATTTTATATTTTTTTGGGGGGG + Intergenic
916201483 1:162275677-162275699 GATTTTGCAGTTTGTAGTGGGGG + Intronic
916436931 1:164785991-164786013 GATTTGACAGTTTTTTGAAGTGG + Intronic
916968157 1:169976245-169976267 CATTTTACTGTTTTCTGTAGTGG + Intronic
917776813 1:178346232-178346254 GATTTTTAAATTTTCTGTAGAGG - Intronic
918135422 1:181669545-181669567 TATTTTATAGTTATTTGTGGAGG + Intronic
921315948 1:213890764-213890786 GGTTTTAGAGCTTTCTGTGAGGG - Intergenic
921617654 1:217289844-217289866 GATTTTGTAATTTTCTGTGGAGG - Intergenic
922879253 1:228967823-228967845 TGTTTTATAGTTTTCTGTGTAGG + Intergenic
923726971 1:236514818-236514840 AATTTTAAAATTTTCTGTAGAGG + Intergenic
924720305 1:246616388-246616410 GATTTTTAAATTTTCTGGGGGGG - Intronic
1062859002 10:795185-795207 GTTTTTACTTTTTTCTTTGGAGG - Intergenic
1063089846 10:2853983-2854005 GATTTGTTAGTATTCTGTGGAGG - Intergenic
1064886309 10:20116263-20116285 TATTTTACTGTTTTCCGGGGGGG - Intronic
1065061111 10:21901681-21901703 GATTGTACAGTATTCTCTGAGGG - Intronic
1066497437 10:35955828-35955850 TATTTTACAATTTCTTGTGGAGG + Intergenic
1067713849 10:48671882-48671904 GGTTTGACACTTTTCCGTGGAGG - Intergenic
1071207158 10:83294787-83294809 GTTTTTACAGTATTCTCTGATGG - Intergenic
1071278762 10:84080282-84080304 GATTTAACATTTTTGTGTAGCGG - Intergenic
1072361116 10:94660355-94660377 GTGTTTACAGTATTCTGTGATGG + Intergenic
1072588610 10:96805899-96805921 GATTTCACCGTTTTCTGTACTGG - Intergenic
1073805995 10:107098554-107098576 GAATTTACTGTTTTCTGTCTGGG + Intronic
1074075840 10:110123625-110123647 GATTTTACCCTCTTCTGTGAAGG + Intronic
1074634800 10:115303174-115303196 GATTCTGCAGCTTTCTATGGTGG - Intronic
1074636265 10:115321447-115321469 GGTTTTTTAGTTTTCTGTAGTGG + Intronic
1074895142 10:117770866-117770888 GATTGTCCAATTTTCTGTGAGGG + Intergenic
1074965982 10:118490997-118491019 GATTTGACAGTTTTATTAGGGGG + Intergenic
1075442376 10:122490282-122490304 GAGTATACAGCTTTTTGTGGGGG + Intronic
1076360876 10:129888173-129888195 GATTTTCCATTTTCCTGTCGGGG + Intronic
1079437549 11:20473034-20473056 GTTTTTATAGTTTTCTTTGATGG + Intronic
1079695813 11:23481480-23481502 TATTTTACAGTGGTCTGTGGGGG + Intergenic
1081144177 11:39541540-39541562 GATTTATTAGTTTTCTTTGGGGG + Intergenic
1081166360 11:39813278-39813300 GTGTTTACAGTATTCTCTGGTGG - Intergenic
1081369065 11:42276340-42276362 GATTTGACGATTTTCTGTAGTGG - Intergenic
1081379555 11:42398113-42398135 GATTTGCCAGTTTTTTGTTGAGG - Intergenic
1083496092 11:63054994-63055016 GATTTGACAGTATTTTGTTGAGG + Intergenic
1085725007 11:78947498-78947520 CTTTTTAAAGTTTTCTGAGGAGG - Intronic
1087596435 11:100260144-100260166 GTGTTTACAGTATTCTCTGGTGG - Intronic
1091329788 11:134722940-134722962 GTGTTTACAGTATTCTCTGGTGG + Intergenic
1091827251 12:3522129-3522151 CAATTTCCAGTTTTTTGTGGGGG - Intronic
1093370376 12:18357271-18357293 GATTTTATAGTTTTGTCAGGAGG + Intronic
1093676605 12:21947733-21947755 GATTTGATAGTTTTCTGTAGTGG - Intergenic
1094772245 12:33676764-33676786 CATTTTAAAATTTTCTTTGGTGG + Intergenic
1095510034 12:42941258-42941280 GTGTTTATAGTTTTCTTTGGTGG + Intergenic
1095763422 12:45867440-45867462 AATTTTAAAATTTTCTGTGCTGG + Intronic
1096149810 12:49301831-49301853 GAATTTACAGTTTGGGGTGGGGG + Intergenic
1097114707 12:56688706-56688728 CTTTTTACAGGTTTTTGTGGTGG - Intergenic
1097765043 12:63516497-63516519 GATGTCACAGTTTTCTCTGTTGG - Intergenic
1097792595 12:63830678-63830700 GCTTTTACAGTATTCTCTGATGG - Intergenic
1098788364 12:74788043-74788065 GAGTTTATAGTATTCTCTGGTGG + Intergenic
1100061997 12:90590986-90591008 GATCATACAGTTTCATGTGGAGG - Intergenic
1100313148 12:93416354-93416376 GGTTTTACACTATTCTTTGGTGG + Intronic
1100895029 12:99171911-99171933 GATTTTAGAGTTTAGTGAGGAGG + Intronic
1102581021 12:113887887-113887909 GTTTTTAAAATTTTCTGTAGAGG + Intronic
1103326460 12:120124610-120124632 GATTTGACAGTTTTGGGTGCAGG - Intergenic
1103792788 12:123483539-123483561 AATTTTACAGATTTCTCTGGGGG + Intronic
1104111159 12:125705860-125705882 GATTTTCAAGTTTTCTGCGATGG + Intergenic
1104349702 12:128034364-128034386 ATTTTTACAGTCTTCTTTGGTGG + Intergenic
1105455295 13:20535069-20535091 GAGCCTACAGTTTTCTTTGGAGG - Intergenic
1106335721 13:28781238-28781260 TATTTTGCAGTTTTCTTTGTAGG + Intergenic
1106954349 13:34919319-34919341 GATTTTACTGATCTCTGGGGAGG + Intergenic
1107061218 13:36161559-36161581 GATTTTACAGTATTTGGGGGGGG + Intergenic
1107210391 13:37846599-37846621 GGTTTGATGGTTTTCTGTGGCGG - Intronic
1108906290 13:55478404-55478426 TATTTGACAGTATTCAGTGGAGG + Intergenic
1109052267 13:57498638-57498660 AACTTCACTGTTTTCTGTGGGGG + Intergenic
1109565471 13:64108646-64108668 GATTTAACAGTTTTCTGCATAGG - Intergenic
1110226716 13:73127347-73127369 GAGATTAAAGTTTTCAGTGGAGG + Intergenic
1110559677 13:76897828-76897850 GATTTTACAGGCTCCTGGGGGGG - Intergenic
1111231780 13:85353878-85353900 TATTTTACTTCTTTCTGTGGGGG - Intergenic
1111510765 13:89259325-89259347 GATTTTACAGTTTTCTGGTTTGG + Intergenic
1112189346 13:97160785-97160807 GATTTTACAGCCTTCTGAAGAGG + Intergenic
1112453369 13:99533118-99533140 GAATTTACAGTATTCTGTTAGGG + Intronic
1112635371 13:101211608-101211630 AATTTTACAGTTTTTTTTGGGGG + Intronic
1113344394 13:109460770-109460792 TATTTTACAGTTTTAAGTGTAGG + Intergenic
1114071467 14:19112129-19112151 GATTTTACTGATCTCTGGGGAGG + Intergenic
1114090795 14:19287839-19287861 GATTTTACTGATCTCTGGGGAGG - Intergenic
1114692541 14:24597824-24597846 GATTTGAATGTTTTCTGTAGTGG + Intergenic
1114708871 14:24756747-24756769 GAGTTTACAGTATTCTCTGATGG - Intergenic
1114875468 14:26711952-26711974 CATATCACAGTTTTCTGGGGGGG + Intergenic
1114995821 14:28350152-28350174 AATTTTATAGTTTTGTCTGGTGG + Intergenic
1116010899 14:39350990-39351012 GTATTTACTATTTTCTGTGGAGG + Exonic
1116212446 14:41965610-41965632 GTTTTTATAGTATTCTCTGGTGG + Intergenic
1116662486 14:47728953-47728975 GAATTTAGATTTTTCTCTGGGGG - Intergenic
1117614182 14:57516349-57516371 GTGTTTATAGTATTCTGTGGTGG + Intergenic
1118655465 14:67942948-67942970 CTTTTGTCAGTTTTCTGTGGTGG + Intronic
1118672669 14:68146441-68146463 GATTCTAAACTTTTTTGTGGGGG - Intronic
1118818665 14:69330553-69330575 GGTTTTTCAGTGCTCTGTGGAGG - Intronic
1119274150 14:73338125-73338147 GATTTTTAATTTTTCTGTAGAGG - Intronic
1119275646 14:73352888-73352910 GATTTTACAGTCTTCTTGTGAGG - Intronic
1119449859 14:74700122-74700144 GATTTTCCAGTGTTCTCTGAAGG + Intronic
1120074901 14:80145180-80145202 GTTTTTACAGGTTTCTTTAGAGG - Intergenic
1120108145 14:80519890-80519912 GAAATTAAAGTTTGCTGTGGTGG + Intronic
1120135931 14:80868534-80868556 GATTTGATAATTTTCTGTAGTGG - Intronic
1120182484 14:81358436-81358458 GATTTTATGGTTTTCTGTAGTGG - Intronic
1121584229 14:95051954-95051976 TATTCTAAAGGTTTCTGTGGGGG - Intergenic
1121865414 14:97358244-97358266 GTCTTGACAGTTTTCAGTGGAGG + Intergenic
1124681837 15:31738574-31738596 GCCATGACAGTTTTCTGTGGAGG + Intronic
1124993809 15:34702732-34702754 GAGTCTATAGGTTTCTGTGGTGG - Intergenic
1126003872 15:44238001-44238023 GATTTGACAGTTTTGTATGGGGG - Intergenic
1126053616 15:44709693-44709715 GATTTTACAGTTTTCTTTGGGGG - Intronic
1126609622 15:50516168-50516190 GATTTGATGGTTTTCTGTGGTGG - Intronic
1127314128 15:57778489-57778511 CATGTTATAGTTTACTGTGGAGG + Intronic
1127687387 15:61361914-61361936 GTGTTTACAGTATTCTGTGATGG + Intergenic
1127907134 15:63384210-63384232 GATTTTATGGCTTGCTGTGGAGG - Intergenic
1128895563 15:71370073-71370095 GTGTTTATAGTGTTCTGTGGTGG + Intronic
1130582319 15:85149175-85149197 GATTTTACAGTTTACTGGAGAGG + Intergenic
1130779472 15:87019960-87019982 GAGTTTATAGTATTCTGTGATGG - Intronic
1130905099 15:88234651-88234673 GGTTGTACAGATTTCTGTGAGGG - Intronic
1131628073 15:94145376-94145398 CATTTTCTAATTTTCTGTGGAGG - Intergenic
1134905211 16:17973967-17973989 GGTTTTAAAGTTTTCTTTGGAGG - Intergenic
1136645671 16:31612254-31612276 GTGTTTACAGTATTCTCTGGTGG - Intergenic
1137242825 16:46672599-46672621 GTTGTTATAGTCTTCTGTGGTGG - Intronic
1138638094 16:58360049-58360071 GATTTTGTAATTTTCTGTAGTGG + Intronic
1138712423 16:58984716-58984738 GGTTTGATGGTTTTCTGTGGTGG - Intergenic
1138908210 16:61363887-61363909 GATTTTAAATTTGCCTGTGGAGG - Intergenic
1140233409 16:73137008-73137030 GATTTTACTGTTTTCTGTTATGG + Intronic
1140681087 16:77385530-77385552 GTTTTTACTTGTTTCTGTGGTGG + Intronic
1144942939 17:18953801-18953823 GATTTTAGAGTTTTGGGTTGGGG + Intronic
1146753472 17:35404186-35404208 GATTTTACTTCTTTCTTTGGAGG + Intergenic
1147123426 17:38350073-38350095 GAATTTACAGTTTTGTAGGGAGG + Intergenic
1147889437 17:43706931-43706953 AATTTAACAGTTTTCTGTGGGGG - Intergenic
1148162152 17:45456502-45456524 GATTTCACACTATTCTATGGGGG + Intronic
1148230224 17:45928250-45928272 CTCTTTACAGTTTTCTGTTGGGG + Intronic
1148621887 17:49041009-49041031 GATTTTTCTATTTTCTGTAGAGG - Intronic
1150393386 17:64803150-64803172 GATTTCACACTATTCTATGGGGG + Intergenic
1150949073 17:69781532-69781554 GGTTTTACAGTTTTCATTGCAGG + Intergenic
1152907652 17:82977663-82977685 GATTTTCTAGTTGTCTGAGGAGG - Intronic
1153157433 18:2165704-2165726 GATTTTACTTTTCTCTGTGTGGG - Intergenic
1153349662 18:4064924-4064946 GATTTTTCAGTATTTTGTTGAGG - Intronic
1153720786 18:7900336-7900358 GTTTTTATAGTTTTCACTGGTGG - Intronic
1154381639 18:13856771-13856793 GTGTTTACAGTTTTCAGTAGAGG + Intergenic
1155383472 18:25250180-25250202 GATTTTACATTTTTCATTGGTGG - Intronic
1155532798 18:26784426-26784448 AACTTAACATTTTTCTGTGGAGG + Intergenic
1155707055 18:28828879-28828901 GACTTTACAGCTTTTTGTAGTGG - Intergenic
1155912388 18:31519107-31519129 GAAGTTTCATTTTTCTGTGGTGG - Intronic
1156852468 18:41744547-41744569 GATTCTGCAGTTTTCTGCAGTGG - Intergenic
1157077662 18:44483216-44483238 GCTTTTACAATTTTCTGTTTTGG - Intergenic
1157308424 18:46534004-46534026 GTTTTTAAAGTTGTCTGGGGTGG + Intronic
1157568169 18:48694171-48694193 GATGTTACTGTTTTCTCTGCAGG + Intronic
1157655931 18:49388160-49388182 AATTTTTAAGTTTTCTGTAGAGG - Intronic
1158277531 18:55784516-55784538 GATTTAGCAGATTCCTGTGGGGG + Intergenic
1158307509 18:56122782-56122804 CATTTTAAGGTTTTTTGTGGTGG + Intergenic
1158637795 18:59176875-59176897 AATTTTACAATTTTCTTTTGTGG + Intergenic
1158982077 18:62772960-62772982 AATTTTAGAGTTTTTTTTGGGGG - Intronic
1159442943 18:68505212-68505234 AATTTGACACTTTTCTGTGTTGG - Intergenic
1159589466 18:70317758-70317780 GAATTTCCAGTTTTCCGTAGTGG + Intronic
1162788916 19:13053144-13053166 GGTTTGACAGTGTTTTGTGGGGG + Intronic
1163326737 19:16608499-16608521 GTGTTTACTGATTTCTGTGGTGG - Intronic
1163942766 19:20510269-20510291 GTTTTTACTGCTTTCTTTGGAGG + Intergenic
1164340051 19:24384699-24384721 GAGTGTACTGTGTTCTGTGGTGG + Intergenic
1164764130 19:30750459-30750481 GATTTTAAAGGGTTCTTTGGTGG + Intergenic
1166156484 19:40916013-40916035 GAGTTTATAGTATTCTCTGGTGG - Intergenic
1166239818 19:41482550-41482572 GAGACTACAGTTTTCTGGGGAGG + Intergenic
1168479217 19:56704192-56704214 GTTTTAACAGTCTTCTTTGGTGG - Intergenic
925094729 2:1187278-1187300 GATTCTAGATTTTTCTGTGAAGG + Intronic
925439877 2:3876313-3876335 AATTTTTGAGCTTTCTGTGGAGG - Intergenic
925468131 2:4129161-4129183 CTATTTACATTTTTCTGTGGAGG + Intergenic
926677289 2:15636684-15636706 GGGTTTCCAGTTTTTTGTGGTGG + Intergenic
926942233 2:18150897-18150919 CATTTTACAATTTTATCTGGAGG - Intronic
929021029 2:37553217-37553239 GATTTATAATTTTTCTGTGGAGG - Intergenic
929180708 2:39035892-39035914 GTTTTTATAGTTCTCAGTGGTGG + Intronic
929723896 2:44403079-44403101 GATATTACAGTTTCCTCTGTGGG + Intronic
930375608 2:50562218-50562240 AATTTTACATTTTTCTAAGGAGG + Intronic
930601514 2:53449177-53449199 GATTTTACATTTTTCAGTTGGGG - Intergenic
930740008 2:54822625-54822647 AAGTTTACAGTTTACTTTGGGGG + Intronic
931095879 2:58940327-58940349 GATTTTAGAGTTTTCTTTCTGGG + Intergenic
932548961 2:72746997-72747019 GCTTTTTCTGTTTTCTTTGGGGG - Intronic
933248000 2:79997184-79997206 GATTTTTCAGCTTTCTGTTTAGG - Intronic
933537803 2:83598798-83598820 GACTTGATGGTTTTCTGTGGTGG - Intergenic
937299224 2:120828738-120828760 CATTTTACCGTTTTGTTTGGAGG - Intronic
937759023 2:125577340-125577362 GATATTACTGGTTTCTGTGATGG - Intergenic
938368176 2:130751780-130751802 TATTTTAAAATTTTATGTGGAGG - Intergenic
939462120 2:142510732-142510754 GATTTAACCACTTTCTGTGGAGG + Intergenic
939532109 2:143375860-143375882 GATTTTACTTTTTTCGGTGATGG + Intronic
939831121 2:147072115-147072137 GATTTTATCCTTTTCTATGGTGG + Intergenic
940101996 2:150051123-150051145 CATTTGACAGTATTCTGAGGTGG + Intergenic
942255190 2:174090022-174090044 GATTTCACAGTCCTCTGTGCTGG - Intronic
942339842 2:174932409-174932431 AATTTGACAGTTTTCTCTAGGGG - Intronic
943120354 2:183727166-183727188 GGTATTACAGCTTTCTGTGGTGG - Intergenic
943930130 2:193839145-193839167 GACTTTACAGTTTTCTTTATTGG + Intergenic
944361079 2:198857533-198857555 AATTTTACAGATTTTTTTGGGGG - Intergenic
944668761 2:201978030-201978052 TATTTGACAATTCTCTGTGGGGG - Intergenic
944766240 2:202866940-202866962 AATTTTACAGTTTTTTGAGATGG - Intronic
944861082 2:203816615-203816637 CATTATTAAGTTTTCTGTGGAGG + Intergenic
944954117 2:204787863-204787885 CATTTTCCAGTTTTCTGTCATGG + Intronic
947382793 2:229561495-229561517 AATTTTAGAGTTTTCTCTGCAGG - Intronic
1169412617 20:5384802-5384824 GGTTTGGCAGTTTTCTGTAGTGG - Intergenic
1169621780 20:7515181-7515203 CATTTCACAGTTGTCTGTAGTGG + Intergenic
1169885830 20:10396324-10396346 GATTTTAAAGTTTTCAGTATAGG - Intergenic
1170051180 20:12147250-12147272 GTTTTTATAGTATTCTCTGGTGG - Intergenic
1170441368 20:16382787-16382809 GCTTATACATTTTTCTGTTGCGG + Intronic
1170604236 20:17863810-17863832 GATTTTCCATTTTTCTGGAGTGG - Intergenic
1171076332 20:22128793-22128815 GATTTGAAATTTTTCTGTAGTGG - Intergenic
1171485910 20:25485818-25485840 GATTCTACAGTGTTCTGTCCAGG + Intronic
1171896613 20:30814721-30814743 GATTTTACTTCTTTCTTTGGAGG - Intergenic
1172831337 20:37837735-37837757 GATATAAAAGTTTTCAGTGGTGG - Intronic
1173997560 20:47350860-47350882 AATTTTACCCTTTTCTGTAGCGG - Intronic
1177648205 21:23926787-23926809 GCTTTCACAGATTTCTGTGTAGG + Intergenic
1178133323 21:29598021-29598043 GATTATAGAGTTTTCTGTTGAGG + Intronic
1179198183 21:39185239-39185261 GAATTTATAATTTGCTGTGGTGG - Exonic
1179362450 21:40724683-40724705 GATTTTACATTTTTATGCTGAGG - Intronic
1180489909 22:15834461-15834483 GATTTTACTGATCTCTGCGGAGG + Intergenic
1184882606 22:47320138-47320160 AATTCTACAGTTTTCTGGGCTGG + Intergenic
1185186545 22:49404315-49404337 GACTCTGCAGTTTTCTCTGGAGG + Intergenic
951922051 3:27865819-27865841 AGTTTTACAGTTTTTTTTGGTGG + Intergenic
952016921 3:28968840-28968862 GATTTGACAGATTTCTGTAGTGG + Intergenic
953212214 3:40886078-40886100 GATATCACAGGTCTCTGTGGAGG + Intergenic
955155256 3:56410587-56410609 GAATTTTGAGTTTTCTGGGGGGG + Intronic
955174696 3:56602365-56602387 GATTTGACAGTATTTTGTTGAGG + Intronic
955315809 3:57938086-57938108 AATTTTAAAATTTTCTGTAGAGG - Intergenic
956116491 3:65924363-65924385 AATTTTACAGTGTTCTGGGGAGG - Intronic
957899884 3:86475768-86475790 GGTTATACAGTTTTCTGTCTTGG + Intergenic
959560401 3:107773297-107773319 GATTTCACTTTTTTCTTTGGTGG - Exonic
960123352 3:113970232-113970254 GATCTAACAGTTTTTTTTGGTGG + Intronic
960861269 3:122156094-122156116 GGTTTGGCAGTATTCTGTGGTGG - Intergenic
961624097 3:128247645-128247667 GAGTTTACAGTTTTATCTTGTGG + Intronic
962197170 3:133374083-133374105 GCTTTTACAGGTTTCTCTTGGGG - Intronic
963325277 3:143855645-143855667 GTTTTTTCAGTTTTTTGTGGGGG + Intergenic
963622771 3:147633380-147633402 ATTTTTACATTTTTCTGTGTAGG + Intergenic
964517177 3:157524762-157524784 GAATTGACAGTTGTTTGTGGTGG + Intronic
965227550 3:166008825-166008847 GTGTTTACAGTATTCTGTGATGG + Intergenic
966101440 3:176273853-176273875 TATTTTTCAGTTTTCTTTGATGG + Intergenic
966906984 3:184533433-184533455 GATTTTATAGTTGTTTATGGTGG + Intronic
969036864 4:4261150-4261172 GATTTTACAGACTGGTGTGGTGG - Intergenic
969157195 4:5221442-5221464 GATTTTACTGTTTGCTGGGATGG + Intronic
970239565 4:13994404-13994426 GATTTTACATTTTTTAGTGAAGG - Intergenic
971060816 4:22967111-22967133 GATTGTGCATTTTTCTCTGGAGG + Intergenic
971211334 4:24620160-24620182 GATTTGATAATTTTCTGTAGTGG + Intergenic
971404687 4:26311570-26311592 GACATTACAGTTTGCTGTGGTGG - Intronic
971592946 4:28492581-28492603 GTGTTTACAGTATTCTCTGGTGG - Intergenic
972532709 4:39976175-39976197 GTTTTTAGAGTTTTTTCTGGAGG - Intronic
972868577 4:43267409-43267431 GATTTTACTCTTTTTTATGGTGG + Intergenic
973102284 4:46288012-46288034 GATCTGACAGTTTTATATGGGGG - Intronic
974128504 4:57724788-57724810 TATTCTACAGCTTTCTGAGGAGG + Intergenic
974707997 4:65547619-65547641 GGTTTTACAATTTTCCTTGGAGG - Intronic
974761883 4:66286855-66286877 TATTTTATAGCTTTCTGTGTAGG + Intergenic
975917395 4:79341115-79341137 CATTTTACAGTTCCCAGTGGTGG - Intergenic
976039667 4:80868471-80868493 GATTTCTCAGCTTTCTGTTGAGG + Intronic
976133778 4:81912918-81912940 GTATTTAAAGTTTTCTGTGTTGG - Intronic
978192840 4:105935208-105935230 GATTTTACTGTGTTATGTTGTGG + Intronic
978633309 4:110773096-110773118 CATTTTACAGTTGTCTGTCTTGG + Intergenic
978866147 4:113513801-113513823 AATTTTACATTTTTATGGGGAGG - Intronic
980396364 4:132221193-132221215 CATTTTAACATTTTCTGTGGTGG + Intergenic
980758315 4:137193952-137193974 GATTTTAGACTTTTCTGCAGTGG + Intergenic
981446096 4:144840023-144840045 GAGTTTATAGTATTCTCTGGTGG - Intergenic
981981463 4:150797356-150797378 TATTTTAAAGTTTTAAGTGGGGG + Intronic
982350142 4:154406482-154406504 GATTTTATAGTTGTTTATGGTGG + Intronic
982353091 4:154437553-154437575 TATTTTATAGGTTTCTTTGGAGG + Intronic
983155190 4:164338308-164338330 GATTTTATAATTTTCTGTAATGG - Intronic
984326809 4:178265361-178265383 GCTTTTACTGCTTTTTGTGGAGG - Intergenic
984627293 4:182021485-182021507 TATTTTAAAGTTTTCTGGGGGGG - Intergenic
987319641 5:16756553-16756575 AATTTTAAAGTTTTCTGAGCTGG - Intronic
987681764 5:21145146-21145168 CAATTTACAGTTGTCTCTGGAGG + Intergenic
989369191 5:40687859-40687881 TATTTTAAAGTTTTCCATGGGGG - Intronic
989402653 5:41025068-41025090 GATTTTCCTGCTTTCTGTTGTGG - Intronic
989797115 5:45489243-45489265 GAATTAATAGTTTTCTGTGTTGG + Intronic
989912580 5:49675843-49675865 GATATTACTGTTTTCTATGAAGG - Intergenic
989913124 5:49684533-49684555 GATATTACTGTTTTCTATGAAGG - Intergenic
989915705 5:49724671-49724693 GATATTACTGTTTCCTGTGAAGG - Intergenic
989916886 5:49742382-49742404 GATATTACTGTTTCCTGTGAAGG - Intergenic
989917333 5:49749031-49749053 GATATTACTGTTTTCTATGAAGG - Intergenic
989922749 5:49828945-49828967 GATATTACTGTTTTCTATGAAGG - Intergenic
989925828 5:49874423-49874445 GATATTACTGTTTCCTGTGAAGG - Intergenic
989936706 5:50035738-50035760 GATATTACTGTTTTCTATGAAGG - Intergenic
991005469 5:61823919-61823941 AGTTTTACAGTGTTGTGTGGTGG - Intergenic
991200808 5:63989244-63989266 AACTTGACAGTTTTCTGTTGTGG + Intergenic
991309858 5:65226055-65226077 GATTTTACTCCTTTCTGTTGGGG - Intronic
993020126 5:82582014-82582036 GTGTTTACAGTATTCTCTGGTGG + Intergenic
993331016 5:86599850-86599872 GATTTGCCAGTATTTTGTGGAGG - Intergenic
993669095 5:90739416-90739438 GCTTTTCTAGTGTTCTGTGGTGG + Intronic
994592454 5:101789777-101789799 GATTTTACAGGTTTGTTAGGGGG + Intergenic
994951306 5:106466903-106466925 TAATTTACAGTGTTGTGTGGAGG - Intergenic
995945419 5:117639241-117639263 GGGTTTACAGTTTTCTGCAGGGG - Intergenic
996451663 5:123632475-123632497 GATTTTCCAGTATTTTGTTGAGG - Intergenic
996475227 5:123910957-123910979 GATTTTATAGTTCTATTTGGAGG - Intergenic
997059636 5:130486065-130486087 AAGTTTACATTTTTCTGGGGAGG + Intergenic
997343161 5:133162553-133162575 ATTTTTAAAGTTTTCTGTAGAGG + Intergenic
998244595 5:140488203-140488225 GTTTTTATTGTTTTCTTTGGGGG + Intronic
999597218 5:153218201-153218223 GTGTTTACAGTATTCTCTGGTGG - Intergenic
1000107609 5:158075278-158075300 GATTATTCAGTTTTGTGTCGAGG - Intergenic
1000304682 5:159984546-159984568 AAATTGACAGTTTTCTGAGGTGG - Intergenic
1202776227 5_GL000208v1_random:76677-76699 GATATTACTGTTTTCTATGAAGG + Intergenic
1202776354 5_GL000208v1_random:78890-78912 GATATTACTGTTTTCTATGAAGG + Intergenic
1202776481 5_GL000208v1_random:81104-81126 GATATTACTGTTTTCTATGAAGG + Intergenic
1005677656 6:28171846-28171868 TATTTTATGGTTTTCTGTGTCGG + Intergenic
1005785545 6:29241771-29241793 GTGTTTACAGTATTCTCTGGTGG + Intergenic
1006209290 6:32380936-32380958 GGTTTTGCAGTTTTCAGTGTAGG - Intergenic
1006517972 6:34555225-34555247 GATTTGCCAGATTTCTGCGGTGG - Intronic
1006582958 6:35087245-35087267 GAATTCACAGTGTTCGGTGGTGG - Intronic
1007016320 6:38470867-38470889 GATTTTAAAGGCTTCTGAGGTGG - Intronic
1007324258 6:41048309-41048331 GAGTTTACAGTCTTCTGTACAGG - Intronic
1007793081 6:44324878-44324900 AATTTTTAAATTTTCTGTGGAGG + Intronic
1008540464 6:52542163-52542185 GATTTTGCATCTTTCTGCGGAGG + Intronic
1009628939 6:66169818-66169840 GAGTTTACAGTATTCTCTGGTGG - Intergenic
1010607932 6:77915162-77915184 GATTTGGCAGTTTTCTGTATCGG + Intronic
1010896571 6:81371897-81371919 AATTTAAAAGTTTTCTGAGGTGG + Intergenic
1011502194 6:88002950-88002972 GATTCTGCAGTTTTCTGCAGTGG + Intergenic
1012550311 6:100458893-100458915 AATTTTAAAATTTTGTGTGGAGG - Intronic
1012571885 6:100739728-100739750 GTGTTTATAGTATTCTGTGGTGG + Intronic
1012707939 6:102558087-102558109 TCTTTTACATTTTTCTATGGAGG + Intergenic
1012847067 6:104403836-104403858 GTTCTTACAGTTTTTTGTAGGGG - Intergenic
1013335374 6:109153411-109153433 GATTTTTAAGTTTTTTGTAGAGG + Intronic
1013913183 6:115303025-115303047 AGTTTTACAGTTTTCAGTGTAGG + Intergenic
1014443916 6:121504529-121504551 GCTTTTGTAGTTTCCTGTGGGGG - Intergenic
1015048086 6:128803076-128803098 GAGTTTCCAGGTTTCTGTGCAGG - Intergenic
1015306399 6:131713349-131713371 GATTGTATAGTTTTTTATGGTGG + Intronic
1015467644 6:133565278-133565300 GTTTTTACTGTTTTTTGTAGAGG - Intergenic
1017554845 6:155551927-155551949 TATATTACAGTTTTGTGTGTCGG + Intergenic
1019961192 7:4461335-4461357 GATTTTACAGCTTTCTCTGGAGG - Intergenic
1020109009 7:5437643-5437665 GATGCTACAGTTATCTGTGGTGG - Intronic
1020408767 7:7867042-7867064 GATGATACAGGTTTCTGTGCTGG + Intronic
1021492832 7:21238382-21238404 TACTTTACAGATCTCTGTGGAGG - Intergenic
1021916695 7:25440895-25440917 GTGTTTATAGTATTCTGTGGTGG + Intergenic
1022256318 7:28662110-28662132 GATTTTACAAAGTTCTCTGGAGG - Intronic
1022319114 7:29271712-29271734 CATTTTACTGCTTTCTTTGGTGG + Intronic
1023815836 7:43949389-43949411 AATTTTAAATTTTTCTGTAGAGG + Intronic
1027433723 7:78141513-78141535 TATTTTAAAGTTTTTTTTGGTGG + Intronic
1027460446 7:78446297-78446319 ATTTTTAAAGTTTTCTGTGATGG + Intronic
1027628523 7:80574563-80574585 GATTTGATGGTTTTCTGTAGTGG + Intronic
1028624349 7:92861830-92861852 GATTTTAGAGTTTTGGGAGGAGG + Intergenic
1029602687 7:101578343-101578365 GATTTTAAAATTTTCTGGGCTGG - Intergenic
1029806232 7:102999951-102999973 GATTTTCCAGTTTCTTGAGGTGG + Intronic
1029912792 7:104173113-104173135 GTTTTTTCAGTTTTTTGTGATGG - Intronic
1031389238 7:121192856-121192878 GATTTTTATGTTTTCTGTTGAGG + Intronic
1031982694 7:128137857-128137879 TATTTTATAATTTTCAGTGGGGG - Intergenic
1032984356 7:137320300-137320322 GATTTTACAGTCCTATGTGTGGG - Intronic
1033305757 7:140224205-140224227 GATGTTTCAGTTCACTGTGGGGG - Intergenic
1033731150 7:144181151-144181173 GATTGTATAGTTTTTTATGGTGG - Intergenic
1033740512 7:144271581-144271603 GATTGTATAGTTTTTTATGGTGG + Intergenic
1034207256 7:149328617-149328639 GATTTTGCAGTCTTTTGTGATGG - Intergenic
1034631497 7:152534099-152534121 GGTCTTAGAGTTTTCTTTGGGGG + Intergenic
1034832634 7:154322587-154322609 AACTTAACAGTTTTCAGTGGCGG + Intronic
1035374243 7:158396876-158396898 GCTTTTACAGTGTTCTCTGGGGG - Intronic
1035997997 8:4570934-4570956 GTATTTATAGTATTCTGTGGTGG + Intronic
1036186978 8:6630963-6630985 GATTTTAGCGGTTTCTGTGTTGG - Intronic
1037982714 8:23266126-23266148 TATTTTATAGTTTTCAGTGTAGG - Intergenic
1038133620 8:24761364-24761386 GATCTTATAATTTTCTGTAGTGG - Intergenic
1039604990 8:38873008-38873030 AATTTTTAAGTTTTCTGTAGTGG - Intergenic
1040665195 8:49623340-49623362 GTGTTTACAGTTTTATTTGGGGG + Intergenic
1041085507 8:54252944-54252966 GATTTTAAAATGTTCTGTTGTGG + Intergenic
1041133476 8:54729596-54729618 GATTTTAAAGTGCTCTTTGGGGG - Intergenic
1041698939 8:60766371-60766393 GACTTTAGATTTTTCTGTGAGGG + Intronic
1041923295 8:63207348-63207370 GATTTTAAAGTTTCCTTTGCCGG + Intronic
1042091509 8:65164665-65164687 GGTTTTACAGTTTGCTTTGGGGG - Intergenic
1042330149 8:67570728-67570750 GATTTGATGGTTTTCTGTAGTGG - Intronic
1042674572 8:71305742-71305764 AATTTTCCAGTTTCCTGTTGTGG - Intronic
1043221930 8:77676696-77676718 GATTTGATAATTTTCTGTAGTGG - Intergenic
1043303475 8:78763921-78763943 AAGTATACAGTTTTATGTGGAGG - Intronic
1043309235 8:78837721-78837743 GTTTTTACAGTTTTATGTTTTGG - Intergenic
1043551972 8:81384775-81384797 GATTTGGTAGATTTCTGTGGTGG + Intergenic
1043630825 8:82330284-82330306 GATTTTACAGTGATGGGTGGAGG + Intergenic
1043926569 8:86043545-86043567 TATTTTTCAGTTTTTTATGGTGG - Intronic
1044548555 8:93486575-93486597 GAGTTTATAGTATTCTGTGATGG - Intergenic
1044765409 8:95567107-95567129 AGTTTTACAGTTTTCTGTCTGGG + Intergenic
1046285227 8:112085160-112085182 GTGTTTATAGTATTCTGTGGTGG - Intergenic
1046342168 8:112873704-112873726 GATTTTATAGTATTCTCTGATGG + Intronic
1047686022 8:127305338-127305360 GATTCTTCAGTTTTATGAGGTGG - Intergenic
1048121570 8:131587626-131587648 GGTTTTACACTTTTCAATGGAGG - Intergenic
1050084783 9:1953042-1953064 TATTTTGCAGTTTTCTTTGAAGG + Intergenic
1051099939 9:13509455-13509477 GATTTTACAGATAGCTGGGGAGG + Intergenic
1054859665 9:69936315-69936337 GATTTTAAAGTATTCTTTTGGGG - Intergenic
1055356678 9:75444658-75444680 GATTTTTCAGTATTTTGTTGAGG + Intergenic
1057323239 9:94033409-94033431 CATTTTTCTGGTTTCTGTGGAGG + Intronic
1057405708 9:94769006-94769028 GATTTTCCTGCCTTCTGTGGAGG + Intronic
1057593949 9:96398598-96398620 GATTTTTTAGTCATCTGTGGAGG - Intronic
1057916624 9:99060716-99060738 ATTTTTACATTTTTCTGTAGAGG - Intronic
1058260115 9:102817728-102817750 GTGTTTACAGTATTCTGTGGTGG - Intergenic
1061068818 9:128296118-128296140 GTTTTTAAAATTTTTTGTGGAGG - Intergenic
1061516720 9:131094405-131094427 GATTTTACAGTTTTCTGTGGAGG - Intronic
1061981611 9:134107749-134107771 CTTTATACAGTTTTCTGTGGTGG - Intergenic
1185675283 X:1844302-1844324 TATTTTACAGTTTTTTGAGATGG - Intergenic
1188653030 X:32654940-32654962 GTGTTTACAGTTTTCTCTGATGG + Intronic
1189813350 X:44800893-44800915 GATTTTAAAATTTTCAGTAGAGG - Intergenic
1190246353 X:48693079-48693101 GATTTCTAAGATTTCTGTGGGGG - Intergenic
1190621193 X:52288358-52288380 GAGTTTCCAGCTTTCAGTGGAGG - Intergenic
1190837780 X:54117189-54117211 AATTTTTAAATTTTCTGTGGAGG - Intronic
1191589527 X:62866916-62866938 GTTTTTCCAGTTTTTTGAGGGGG + Intergenic
1191978088 X:66895836-66895858 TGTTGTAAAGTTTTCTGTGGGGG - Intergenic
1192986173 X:76401058-76401080 GATTTGATGGTTTTCTGTGGTGG - Intergenic
1192999195 X:76545412-76545434 GTGTTTATAGTCTTCTGTGGTGG + Intergenic
1193818972 X:86138942-86138964 GATTGTACAGTTCTCCGTGTTGG - Intergenic
1193933844 X:87590304-87590326 GATTATATCGTTTTCTGGGGGGG - Intronic
1193991326 X:88311393-88311415 GATTTTCCAGCTTTCTGATGTGG - Intergenic
1195466960 X:105190190-105190212 GCTGTTACACTTTTCTGTGCTGG + Intronic
1195483790 X:105379106-105379128 AACTTTACAGTATTCTATGGGGG + Intronic
1195848256 X:109253147-109253169 GATTTGATAATTTTCTGTAGTGG + Intergenic
1196595125 X:117536985-117537007 GATTTTACCATTTTCAATGGTGG + Intergenic
1197714198 X:129694590-129694612 GTTTTTAAATTGTTCTGTGGAGG + Intergenic
1198196595 X:134369328-134369350 CATTTTAAATGTTTCTGTGGGGG - Intergenic
1198937990 X:141919172-141919194 GCTTTTCCAGTTTTCGGTAGAGG - Intergenic
1199461726 X:148093148-148093170 GAATTAACAGTGTTCTTTGGTGG + Intergenic
1200112614 X:153749571-153749593 GATTTTACAGATGAATGTGGAGG - Intergenic
1200825696 Y:7637751-7637773 TCTTTTACAGTTTTCATTGGAGG + Intergenic
1200848970 Y:7862860-7862882 TATTTCACAGTTTCCTCTGGGGG + Intergenic
1200984314 Y:9289863-9289885 GATTTTGCAGTTTTTTCTTGGGG + Intergenic
1201368996 Y:13239937-13239959 GATTTGGCAGTTATCTGTAGTGG - Intergenic
1201394995 Y:13538653-13538675 GATCTGACAGTTTTATTTGGTGG + Intergenic
1201625460 Y:16010023-16010045 GTGTTTACAGTATTCTGTGATGG + Intergenic
1202105687 Y:21362092-21362114 TTTTTTACAGTTTTCACTGGAGG + Intergenic
1202126129 Y:21570376-21570398 GATTTTGCAGTTTTTTCTTGGGG - Intergenic
1202152875 Y:21859030-21859052 GATTTTGCAGTTTTATCTTGGGG + Intergenic
1202201933 Y:22361837-22361859 TCTTTTACAGTTTTCATTGGTGG - Intronic
1202234359 Y:22693337-22693359 TCTTTTACAGTTTTCATTGGAGG - Intergenic
1202308800 Y:23502829-23502851 TCTTTTACAGTTTTCATTGGAGG + Intergenic
1202343358 Y:23892786-23892808 GTGTTTACAGTTTTCTCTGATGG - Intergenic
1202527410 Y:25777299-25777321 GTGTTTACAGTTTTCTCTGATGG + Intergenic
1202562001 Y:26167759-26167781 TCTTTTACAGTTTTCATTGGAGG - Intergenic