ID: 1061516726

View in Genome Browser
Species Human (GRCh38)
Location 9:131094420-131094442
Sequence GTAAAATCAAGGCTACGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061516720_1061516726 -8 Left 1061516720 9:131094405-131094427 CCTCCACAGAAAACTGTAAAATC 0: 1
1: 1
2: 2
3: 30
4: 385
Right 1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1061516718_1061516726 28 Left 1061516718 9:131094369-131094391 CCTAATGGGAGATGGTGTTCAGA 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061516726 Original CRISPR GTAAAATCAAGGCTACGGTG GGG Intronic
906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG + Intergenic
908009397 1:59760225-59760247 GGAAAATCAAAACTACCGTGAGG + Intronic
919037824 1:192338687-192338709 GAAAAGTTAAGGCTACAGTGTGG - Intronic
1063232637 10:4080795-4080817 GTAAAATCAGGGCGATGGGGTGG - Intergenic
1063751701 10:8956259-8956281 GTAAAAAGAAGGCTGCTGTGAGG + Intergenic
1076115782 10:127898365-127898387 GAAATTTCCAGGCTACGGTGTGG - Intergenic
1080461625 11:32459690-32459712 GGAAAATCAAGCCTAAGCTGAGG - Intergenic
1090719573 11:129459292-129459314 GTAAATTCAGGGCAACTGTGAGG - Intergenic
1091769568 12:3142229-3142251 GTAAAATAAAGGCTGCAGTGAGG - Intronic
1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1095392580 12:41726705-41726727 CTCAAACCAAGGCTTCGGTGGGG - Intergenic
1100647963 12:96551183-96551205 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1100867121 12:98868815-98868837 CTAAAATAAAGGGTAGGGTGGGG + Intronic
1104252177 12:127105477-127105499 GGGAAATCAAGGCTGCAGTGAGG - Intergenic
1104436933 12:128764182-128764204 CCAAAATCAAGGCTTCGCTGAGG + Intergenic
1107364751 13:39658214-39658236 GCAAGATCAAGGCTACAGTAAGG - Intronic
1113084443 13:106553952-106553974 ATAAAACAAAGGCTAGGGTGTGG - Intronic
1115204524 14:30887495-30887517 GTAATATTAAGGCTGGGGTGAGG - Intronic
1118065913 14:62190012-62190034 GAAACATCAAGGCTATGGGGGGG - Intergenic
1121163533 14:91769320-91769342 GTATAATCCAGGCCACGGTGCGG - Intronic
1125266803 15:37891007-37891029 GTAAAAGCAATGCTAGGGTATGG - Intergenic
1126580083 15:50234684-50234706 GGCAAATCAAGGCTGCAGTGAGG + Intronic
1128658048 15:69476960-69476982 GAAAAAACGAGGCTACAGTGAGG - Intergenic
1133950198 16:10385271-10385293 GCAAACTCAAGGCTATGGTGCGG + Intronic
1134304738 16:13021966-13021988 CTGAAATCAAGGCTTTGGTGGGG + Intronic
1137314480 16:47302073-47302095 ATAAAAGCAATGCTATGGTGTGG + Intronic
1143851005 17:9812017-9812039 TTCAAAGCAAGGCTAAGGTGGGG - Intronic
1144958205 17:19030291-19030313 GGAAAAACAAGGCTGGGGTGGGG + Intronic
1144976953 17:19144233-19144255 GGAAAAACAAGGCTGGGGTGGGG - Intronic
1146236066 17:31164041-31164063 GTATCATCAAGGTTACTGTGAGG - Intronic
1147925724 17:43944385-43944407 GAAAAATGAAAGCTACGGTTTGG - Intergenic
1155447752 18:25929705-25929727 GTGAAATAAAGGCTAGGCTGGGG + Intergenic
1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG + Intronic
1166302837 19:41921976-41921998 GTAGAATGAAGGCAAGGGTGGGG - Intronic
927846621 2:26475631-26475653 TTAAAATCAAGGCTAATATGAGG + Intronic
930072296 2:47376548-47376570 GGAACATCAAGGCTCGGGTGAGG - Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1169997093 20:11570791-11570813 CTAAAATCAAGGCACTGGTGAGG + Intergenic
955078960 3:55640145-55640167 AGAAAATCAAGGCAAGGGTGTGG - Intronic
956901740 3:73723589-73723611 GTAGAATCAAGCCAATGGTGTGG - Intergenic
967100113 3:186209501-186209523 TTGAAATAAAGGCTATGGTGGGG + Intronic
967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG + Intronic
970197809 4:13570138-13570160 GCAAAGTCAAGGCAATGGTGAGG + Intronic
970581305 4:17476663-17476685 GTAAAATAAAGGCCACTGGGGGG - Intronic
979094986 4:116536611-116536633 GAATAATCAAGGATATGGTGAGG - Intergenic
981156683 4:141445604-141445626 GTAAAATGATGGCTGTGGTGGGG + Intergenic
983253880 4:165377168-165377190 GTAAAATCATGCCTACTATGTGG - Intronic
989038753 5:37204330-37204352 GTAAAACCAGGGCAACTGTGAGG - Intronic
989485981 5:41992360-41992382 CTAAAATCAAGGGTCTGGTGTGG + Intergenic
990887731 5:60614191-60614213 ATAAAATCAAGGCTCAGATGGGG - Intronic
992852637 5:80826010-80826032 CTAAACTCAAGGCTCAGGTGTGG + Intronic
996846454 5:127904250-127904272 CTAAAATCAAGGTTACAGTAAGG - Intergenic
1000900739 5:166909039-166909061 GTAAGATAAAGGCAATGGTGGGG + Intergenic
1002994992 6:2274612-2274634 GTAAACTAAAGGCAATGGTGAGG - Intergenic
1006459875 6:34152135-34152157 GTAGAACCAAGGCTAGAGTGTGG - Intronic
1022547486 7:31202299-31202321 AGAGAATCAAGGCTACTGTGGGG + Intergenic
1022977243 7:35570065-35570087 GTAAAATCAAGACTCCGGCTTGG + Intergenic
1023674944 7:42619191-42619213 TTAAAATCAAGACTAAGGTTTGG - Intergenic
1024847349 7:53662392-53662414 GTAGAATAAAGGTTACTGTGGGG - Intergenic
1030736819 7:113058910-113058932 GTGGAACCAAGGCTTCGGTGTGG - Intergenic
1031262325 7:119536597-119536619 GTAAAAGCAAGGTTAATGTGAGG - Intergenic
1032855446 7:135829948-135829970 ATAAAATCAAGACTACGGCTGGG + Intergenic
1033974509 7:147083205-147083227 GTAAAATCAAGGCTTGTCTGAGG + Intronic
1040299713 8:46181535-46181557 GCAAAAACAAGGCCACAGTGTGG - Intergenic
1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG + Intergenic
1042310611 8:67375577-67375599 CTAAAATCAAGGCATCAGTGGGG + Intergenic
1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1198377352 X:136052976-136052998 CTAAAATCAAGGGGACGGTGGGG - Intergenic