ID: 1061516802

View in Genome Browser
Species Human (GRCh38)
Location 9:131094887-131094909
Sequence CAGTCCAGCAGCTGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061516800_1061516802 19 Left 1061516800 9:131094845-131094867 CCGGGTGGAATGCGGCAGCTGTT No data
Right 1061516802 9:131094887-131094909 CAGTCCAGCAGCTGAGCAGAAGG No data
1061516799_1061516802 25 Left 1061516799 9:131094839-131094861 CCGCTGCCGGGTGGAATGCGGCA No data
Right 1061516802 9:131094887-131094909 CAGTCCAGCAGCTGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061516802 Original CRISPR CAGTCCAGCAGCTGAGCAGA AGG Intergenic
No off target data available for this crispr