ID: 1061517308

View in Genome Browser
Species Human (GRCh38)
Location 9:131097138-131097160
Sequence GCTTGCGGGGAGCCACGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 428}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061517308_1061517314 -2 Left 1061517308 9:131097138-131097160 CCGGCTCGTGGCTCCCCGCAAGC 0: 1
1: 0
2: 0
3: 22
4: 428
Right 1061517314 9:131097159-131097181 GCCCGCTTGGGAGCAGCCCAAGG No data
1061517308_1061517317 4 Left 1061517308 9:131097138-131097160 CCGGCTCGTGGCTCCCCGCAAGC 0: 1
1: 0
2: 0
3: 22
4: 428
Right 1061517317 9:131097165-131097187 TTGGGAGCAGCCCAAGGATTTGG No data
1061517308_1061517321 14 Left 1061517308 9:131097138-131097160 CCGGCTCGTGGCTCCCCGCAAGC 0: 1
1: 0
2: 0
3: 22
4: 428
Right 1061517321 9:131097175-131097197 CCCAAGGATTTGGCGCGGGAAGG No data
1061517308_1061517323 15 Left 1061517308 9:131097138-131097160 CCGGCTCGTGGCTCCCCGCAAGC 0: 1
1: 0
2: 0
3: 22
4: 428
Right 1061517323 9:131097176-131097198 CCAAGGATTTGGCGCGGGAAGGG No data
1061517308_1061517318 9 Left 1061517308 9:131097138-131097160 CCGGCTCGTGGCTCCCCGCAAGC 0: 1
1: 0
2: 0
3: 22
4: 428
Right 1061517318 9:131097170-131097192 AGCAGCCCAAGGATTTGGCGCGG No data
1061517308_1061517324 22 Left 1061517308 9:131097138-131097160 CCGGCTCGTGGCTCCCCGCAAGC 0: 1
1: 0
2: 0
3: 22
4: 428
Right 1061517324 9:131097183-131097205 TTTGGCGCGGGAAGGGCCCTAGG No data
1061517308_1061517319 10 Left 1061517308 9:131097138-131097160 CCGGCTCGTGGCTCCCCGCAAGC 0: 1
1: 0
2: 0
3: 22
4: 428
Right 1061517319 9:131097171-131097193 GCAGCCCAAGGATTTGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061517308 Original CRISPR GCTTGCGGGGAGCCACGAGC CGG (reversed) Intronic
900406814 1:2496402-2496424 GCTGGCTGGGAGCTACCAGCAGG - Intronic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
901942438 1:12673715-12673737 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
903870542 1:26431442-26431464 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
904034221 1:27550435-27550457 GCTTGCCGGGACCCAGCAGCAGG + Exonic
904599633 1:31666280-31666302 GCTTGCAGTGAGCCAGGAGGTGG - Intronic
905339351 1:37267596-37267618 GCTTGCAGGGAGGCAGGAGGAGG - Intergenic
905725184 1:40245447-40245469 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
906019547 1:42615358-42615380 GGTTGCGGTGAGCCAAGATCAGG - Intronic
906097957 1:43236844-43236866 GCTTGCAGTGAGCCAAGATCGGG + Intronic
906393145 1:45436550-45436572 GGTTGCGGTGAGCCAAGATCGGG - Intronic
906437774 1:45811694-45811716 GCTTGCAGTGAGCCAAGATCAGG - Intronic
907493307 1:54825111-54825133 GCTTGCAGTGAGCCAAGATCAGG - Intronic
911086750 1:93985277-93985299 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
911859297 1:102927578-102927600 GCTTGCAGTGAGCCGAGAGCAGG + Intronic
912268032 1:108178749-108178771 GCTTGCAGTGAGCCAAGATCGGG + Intronic
912800217 1:112715399-112715421 GCTGGCCGGGAGCCAGTAGCAGG - Exonic
913203340 1:116513784-116513806 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
913644750 1:120845178-120845200 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914081977 1:144418405-144418427 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914099127 1:144568424-144568446 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914176884 1:145286905-145286927 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914299860 1:146369240-146369262 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914340031 1:146752572-146752594 GGTTGCGGGGAGGCAGCAGCAGG - Intergenic
914376945 1:147080209-147080231 GCTGGCGGGCAGACACTAGCAGG + Intergenic
914531612 1:148528397-148528419 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914636779 1:149559332-149559354 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
917081980 1:171264834-171264856 GCTTGCAGTGAGCCAAGATCGGG + Intronic
918180383 1:182081896-182081918 GAGTGTGGGGAGCCATGAGCTGG + Intergenic
918515380 1:185357915-185357937 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
919777034 1:201200892-201200914 GCTTGCAGTGAGCCAAGATCCGG - Intronic
920262431 1:204698365-204698387 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
921728592 1:218552122-218552144 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
921741086 1:218685989-218686011 GCTTGCAGGGAGCCGAGATCGGG - Intergenic
921934702 1:220786279-220786301 ACCGGCGGGGAGCCTCGAGCTGG - Intergenic
922496688 1:226062853-226062875 GCTTGCCGTCAGCCCCGAGCCGG + Intronic
922512870 1:226184126-226184148 GCTTGCAGTGAGCCCCGAGATGG + Intronic
922678128 1:227565820-227565842 GCTTGCAGTGAGCCAAGATCAGG - Intronic
922910564 1:229212336-229212358 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
923458681 1:234188172-234188194 GGTTGCGGTGAGCCAAGATCGGG + Intronic
923522040 1:234742497-234742519 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
923983515 1:239353316-239353338 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
924819821 1:247478559-247478581 GGTTGCGGTGAGCCAGGATCAGG - Intergenic
924875277 1:248096318-248096340 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1062863280 10:827211-827233 GCTTGCAGTGAGCCAAGATCCGG + Intronic
1064043666 10:11990923-11990945 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1064174733 10:13064721-13064743 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1064765298 10:18664498-18664520 GCTTGCGGTGAGCCGAGATCGGG - Intronic
1065015592 10:21460059-21460081 GCTTGCAGGGAGCCGAGATCTGG - Intergenic
1065690010 10:28323220-28323242 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1065696877 10:28388320-28388342 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1065914171 10:30338610-30338632 GGTTGCAGTGAGCCACGATCAGG + Intronic
1066733084 10:38450999-38451021 GTTTGCTGGGAGGCAGGAGCTGG + Intergenic
1067481174 10:46598624-46598646 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1067665649 10:48275593-48275615 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1069628039 10:69880392-69880414 GCTGGCAGGGGGCCAGGAGCAGG - Intronic
1070152954 10:73816521-73816543 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1070183434 10:74036971-74036993 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1070937302 10:80310027-80310049 GCTTGCAGTGAGCCAAGATCTGG + Intergenic
1070992449 10:80744355-80744377 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1071628985 10:87203190-87203212 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1073265144 10:102223264-102223286 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
1073778515 10:106812061-106812083 GCTTGCAGTGAGCCAGGATCGGG - Intronic
1074739195 10:116468060-116468082 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1074743335 10:116506237-116506259 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1076052878 10:127349263-127349285 GCTTGGGGGCAGCCAGGACCTGG - Intronic
1076075775 10:127532813-127532835 CCTTGCTGGTAGCCAAGAGCTGG - Intergenic
1076779585 10:132716875-132716897 TCGTGCGGGGAGCCCCGTGCAGG - Intronic
1076879043 10:133231062-133231084 GCTGGCGGGGAGCCGGGGGCGGG - Exonic
1077942190 11:6855068-6855090 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1079652745 11:22950560-22950582 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1084520626 11:69660489-69660511 GCTTGCAGTGAGCCGAGAGCAGG - Intronic
1088126731 11:106434812-106434834 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1089374153 11:117982689-117982711 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1089897032 11:121940932-121940954 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
1090092615 11:123712071-123712093 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
1092045769 12:5431172-5431194 ACTTTCGGGGCGCCACGAACAGG + Intergenic
1092248747 12:6879562-6879584 GGTTGCGGTGAGCCAAGATCAGG + Intronic
1092343508 12:7696462-7696484 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1093508835 12:19902748-19902770 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1094594909 12:31856469-31856491 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1094657220 12:32432120-32432142 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1095761200 12:45838926-45838948 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1095776281 12:46013517-46013539 GGTTGCAGTGAGCCAGGAGCGGG - Intergenic
1096125900 12:49119300-49119322 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1096374203 12:51094524-51094546 GCTTGCTAGGTGCCAGGAGCTGG - Exonic
1096749588 12:53750376-53750398 GCTAGCCTGGAGCAACGAGCTGG + Intergenic
1096794583 12:54067755-54067777 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1097059226 12:56270023-56270045 TCTTACGGGGATCCACGAACTGG + Intronic
1098114231 12:67157285-67157307 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1098206135 12:68111647-68111669 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1098419975 12:70285270-70285292 GCTTGCGGTGAGCCGAGATCAGG - Intronic
1099294929 12:80818219-80818241 GCTTGCAGTGAGCCAAGATCCGG - Intronic
1100083852 12:90883208-90883230 GCTTGCAGTGAGCCAAGATCTGG + Intergenic
1100915000 12:99410604-99410626 GCTTGCAGGGAGCCGAGATCGGG + Intronic
1100924757 12:99532421-99532443 GCTTGCAGGGAGCCGAGATCGGG - Intronic
1100953945 12:99885361-99885383 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1102037973 12:109782984-109783006 GCCTGGGGGGAGCCAGGGGCAGG - Intergenic
1103346828 12:120256778-120256800 GGTTGCGGTGAGCCAAGATCAGG - Intronic
1103768352 12:123299616-123299638 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1103954288 12:124567690-124567712 GCGGGCGGGGAGCCGGGAGCAGG - Intergenic
1104324511 12:127783751-127783773 GGTTGCGGTGAGCCAAGATCGGG - Intergenic
1105539929 13:21307493-21307515 GCATGCAGAGAGCCTCGAGCAGG - Intergenic
1105684019 13:22759646-22759668 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1105798396 13:23880557-23880579 GCATGCAGAGAGCCTCGAGCAGG + Intronic
1106574592 13:30962883-30962905 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1108754417 13:53482497-53482519 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1108953460 13:56119816-56119838 GCTTGCGGTGAGCCAAGATCGGG + Intergenic
1109017019 13:57029694-57029716 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1109511408 13:63379278-63379300 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1110224640 13:73106556-73106578 TGTTGCGGGGAGCCAAGATCTGG + Intergenic
1110365957 13:74685928-74685950 GCTTGCAGTGAGCCATGATCGGG + Intergenic
1110807262 13:79770767-79770789 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1113408235 13:110061730-110061752 GCTTGTGTGTAGCCAAGAGCAGG - Intergenic
1113809124 13:113126915-113126937 GGTTGCAGGGAGCCACGTGTGGG + Intronic
1114028327 14:18550998-18551020 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1114471752 14:22967946-22967968 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1116850025 14:49899328-49899350 GCTTGCAGTGAGCCGAGAGCGGG + Intergenic
1117371613 14:55083734-55083756 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1118188730 14:63560799-63560821 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
1119053202 14:71391167-71391189 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1119918640 14:78426018-78426040 GGTTGTGGGTAGCCAGGAGCAGG + Intronic
1120737041 14:88064704-88064726 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
1121293756 14:92799337-92799359 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1122554891 14:102573053-102573075 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1202900277 14_GL000194v1_random:32492-32514 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1123739511 15:23223057-23223079 GCTTGCGGTGAGCCGAGATCCGG - Intergenic
1124290732 15:28452029-28452051 GCTTGCGGTGAGCCGAGATCCGG - Intergenic
1124292504 15:28465529-28465551 GCTTGCGGTGAGCCGAGATCCGG + Intergenic
1124926174 15:34072709-34072731 GCTTGCAGTGAGCCAAGATCTGG - Intergenic
1125215924 15:37274289-37274311 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1125485620 15:40108883-40108905 GTTTGCGGGATGCCCCGAGCAGG - Intronic
1125548721 15:40528410-40528432 GCTTGCGTGGAGCCAGGACTGGG + Intergenic
1125842484 15:42816854-42816876 GGTTGCGGTGAGCCAAGATCGGG + Intronic
1125906672 15:43399264-43399286 ACTTGCAGGGAGGCAGGAGCGGG + Intronic
1125996140 15:44162802-44162824 GGTTGCGGTGAGCCAAGATCGGG + Intronic
1126963823 15:54028751-54028773 GCTTGCGGTGAGCCAAGATTGGG - Intronic
1127017878 15:54708620-54708642 TCTTGCGGGGAACCGGGAGCAGG - Intergenic
1129405087 15:75311854-75311876 TATTGCGGGAAGCCACCAGCAGG + Intergenic
1129836879 15:78714264-78714286 TATTGCGGGAAGCCACGAGCAGG + Intronic
1130564536 15:84982117-84982139 GCTGGCGGGTAGCCGCGATCCGG - Exonic
1131207420 15:90462103-90462125 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1131371818 15:91888175-91888197 GCTGGCTGGGAGTCAGGAGCTGG + Intronic
1132224129 15:100127405-100127427 GGTTGCCGGGAGCCACGAAACGG + Intronic
1133007046 16:2889271-2889293 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1133087840 16:3379054-3379076 GCTTGCGGTGAGCCGAGATCAGG - Intronic
1137648662 16:50098591-50098613 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1138217879 16:55221181-55221203 ACTTGCTGTGAGCCACAAGCAGG + Intergenic
1139400976 16:66681377-66681399 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1139414328 16:66794845-66794867 GCTTGCAGTGAGCCAAGATCCGG + Intronic
1139893441 16:70269255-70269277 GGTTGCGGTGAGCCAAGATCGGG + Intronic
1139994257 16:70964836-70964858 GGTTGCGGGGAGGCAGCAGCAGG + Exonic
1141352709 16:83312972-83312994 GCTTGCAGGGAGTCACTAGAAGG + Intronic
1142256410 16:89015775-89015797 GGGTGCGGGGAGCCTCGGGCAGG - Intergenic
1142603986 17:1071631-1071653 GCTTGCGGGGAGCCCACAGCAGG - Intronic
1142900113 17:3006494-3006516 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1143007186 17:3844785-3844807 GGTTGCGGTGAGCCAAGATCAGG + Intronic
1143081365 17:4383879-4383901 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1143326921 17:6105100-6105122 GCTGGCGGGGATCCACATGCGGG - Intronic
1143641908 17:8203781-8203803 GGTTGCGGTGAGCCAAGATCGGG + Intergenic
1143708080 17:8714349-8714371 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1144546032 17:16196760-16196782 GCTTGCCGTGAGCCAAGATCGGG + Intronic
1144673615 17:17146913-17146935 GCTTGCGGGCTGCCACCTGCAGG + Intronic
1144756582 17:17683292-17683314 GCGTGATGGGAGCCCCGAGCTGG + Intronic
1146115939 17:30138978-30139000 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1146518260 17:33506348-33506370 GCTTGCAGCGAGCCAAGATCTGG + Intronic
1146757093 17:35442504-35442526 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1147758149 17:42781629-42781651 GATTGCGGGTACCCACCAGCAGG - Intronic
1147758183 17:42781752-42781774 GGATGCGGGAAGCCAGGAGCTGG + Intronic
1147944496 17:44073028-44073050 GCTGGCAGGAAGCCACGTGCTGG - Intronic
1149397403 17:56258846-56258868 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1149658783 17:58324015-58324037 GCTTGGGGGAAGCCAGGAGAAGG - Intronic
1149874716 17:60220704-60220726 GCTTGCGGTGAGCCGAGATCGGG - Intronic
1150088505 17:62297944-62297966 GCTTGCGGTGAGCCGAGATCGGG - Intergenic
1150114833 17:62538096-62538118 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1150259965 17:63781278-63781300 GCTTGCGGTGAGCCAAGATCCGG - Intronic
1150930924 17:69584592-69584614 GGTTGCGGTGAGCCAAGATCGGG - Intergenic
1151763784 17:76121959-76121981 GGTTGCCTGGAGCCACGGGCCGG - Intergenic
1151778138 17:76222951-76222973 GCTTGCAGTGAGCCAGGATCGGG - Intronic
1152055703 17:78024427-78024449 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1153637044 18:7121470-7121492 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1153663285 18:7345069-7345091 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1153993259 18:10418470-10418492 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1154210484 18:12375606-12375628 GCTGGCAGTGAGCCAAGAGCGGG - Intronic
1155046653 18:22109098-22109120 GCTTGAAGGGGGCCACGAGGAGG - Intergenic
1155654689 18:28178467-28178489 GCTCGCCGGGAGCCACCTGCGGG + Intergenic
1156315229 18:35963339-35963361 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
1156810202 18:41240056-41240078 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1158459977 18:57637734-57637756 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1159728394 18:71993234-71993256 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1159771155 18:72546372-72546394 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1159774397 18:72586127-72586149 GCAAGCGGGGAGCCAGGAACAGG - Intronic
1159952761 18:74496786-74496808 GGTTGCGGGGAGCCGAGCGCTGG + Intronic
1160756238 19:758405-758427 GCTTGCGGGCATCCCCGAGGGGG - Exonic
1160927156 19:1552223-1552245 GCTTCCGGGGAGCCCCAAGTGGG - Intergenic
1160973164 19:1778999-1779021 GCATGCGGGGAGGCAGGAGAGGG - Exonic
1161482205 19:4516856-4516878 GCTTGGGGGGAGCCCCCAGCGGG - Intronic
1161677717 19:5661945-5661967 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1161922174 19:7274740-7274762 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163338684 19:16690122-16690144 GGTTGCAGGGAGCCAAGATCGGG - Intergenic
1163531490 19:17852015-17852037 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1164624135 19:29715299-29715321 CCTTCCGGGAAGCCACGCGCCGG + Intronic
1165091444 19:33390302-33390324 GTGTGCAGGGAGCCAAGAGCTGG - Intronic
1166131145 19:40746436-40746458 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1166350071 19:42193153-42193175 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1167128309 19:47566986-47567008 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1167156577 19:47742702-47742724 GCTTCCAGGGGGCCAGGAGCAGG - Exonic
1167234960 19:48308825-48308847 TCTTGCAGGGAGCCAGGAGCAGG + Intronic
1167931619 19:52870413-52870435 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1168468211 19:56620953-56620975 GCTTGCAGGGAGCAAAGGGCAGG - Intronic
925516847 2:4692296-4692318 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
927970402 2:27302381-27302403 GCTTGCAGTGAGCCAAGATCGGG + Intronic
928931487 2:36629462-36629484 GCTTGCAGTGAGCCAAGATCAGG + Intronic
929517335 2:42615781-42615803 GCTTGCAGTGAGCCAAGATCAGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930779649 2:55211437-55211459 GCTTGCAGTGAGCCAAGATCAGG + Intronic
933235778 2:79863272-79863294 GCTTGGGGTGAGCAAAGAGCAGG - Intronic
934321258 2:91974193-91974215 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
935553146 2:104479551-104479573 GCTTGCAAAGAGCCAAGAGCAGG + Intergenic
936643427 2:114342299-114342321 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
936886726 2:117319349-117319371 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
937231546 2:120400862-120400884 GCTTCCGGGGCCCAACGAGCTGG - Intergenic
937968888 2:127535042-127535064 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
940119731 2:150250726-150250748 GCTTGCAGTGAGCCAAGATCCGG + Intergenic
940939173 2:159538057-159538079 GGTTGCGGTGAGCCAAGATCGGG - Intronic
944163848 2:196695746-196695768 GCTTGCAGTGAGCCAAGATCAGG + Intronic
945241778 2:207682846-207682868 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
945731330 2:213540095-213540117 GCTTGCAGTGAGCCAAGATCGGG - Intronic
946243890 2:218374414-218374436 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
946865523 2:224038846-224038868 GCCCGCCGGGAGCCCCGAGCGGG - Intronic
947431091 2:230028340-230028362 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
948516052 2:238504603-238504625 GCTTGGGTGGAGCCCCGAGGGGG + Intergenic
948862635 2:240760307-240760329 GCTGGCGGAGCGCCAAGAGCGGG - Intronic
1170627796 20:18042711-18042733 GGTTGCGGTGAGCCAAGATCGGG + Intronic
1171292053 20:23987981-23988003 GCTTGCGGTGAGCCGAGATCAGG + Intronic
1176619649 21:9047270-9047292 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1176700389 21:10040759-10040781 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1178393383 21:32218128-32218150 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1179012285 21:37565009-37565031 GCTTGCGGGAGTCCAGGAGCTGG + Intergenic
1179106628 21:38406090-38406112 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1180452449 22:15478050-15478072 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1180679960 22:17618617-17618639 GCTTGCAGTGAGCCAAGATCTGG + Intronic
1180754559 22:18151989-18152011 GCTTGCAGTGAGCCAAGATCCGG + Intronic
1180823112 22:18845738-18845760 GCTTGCGGTGAGCCGAGATCAGG + Intergenic
1181189632 22:21128810-21128832 GCTTGCGGTGAGCCGAGATCAGG - Intergenic
1181189848 22:21130276-21130298 GCTTGCGGTGAGCCGAGATCAGG - Intergenic
1181209356 22:21280229-21280251 GCTTGCGGTGAGCCGAGATCAGG + Intergenic
1181209571 22:21281694-21281716 GCTTGCGGTGAGCCGAGATCAGG + Intergenic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1181416715 22:22764897-22764919 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1181502554 22:23325957-23325979 GCTTGCGGTGAGCCGAGATCAGG - Intergenic
1181707905 22:24659940-24659962 GCTTGCGGTGAGCCGAGATCAGG - Intergenic
1181708118 22:24661403-24661425 GCTTGCGGTGAGCCGAGATCGGG - Intergenic
1182224392 22:28784831-28784853 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1182321779 22:29482426-29482448 GTTTCCTGGGAACCACGAGCGGG + Intronic
1182699488 22:32223981-32224003 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1183189613 22:36313387-36313409 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1183189888 22:36315340-36315362 GTTTGAGAGGAGCCATGAGCTGG - Intronic
1183382301 22:37496312-37496334 GCAGGCGGGGAGCCAGGAGAAGG + Intronic
1183692903 22:39400969-39400991 GCTTGCAGCGAGCCAAGATCGGG + Intronic
1183707601 22:39484005-39484027 GCTTGCGAGGAGTCCTGAGCAGG - Intronic
1183861130 22:40670972-40670994 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
1184207168 22:43012713-43012735 GGTTGCGGTGAGCCAAGATCCGG - Intronic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1184512704 22:44942718-44942740 GCTGTCGGGGAGCCACGTGGAGG + Intronic
1203217376 22_KI270731v1_random:13741-13763 GCTTGCGGTGAGCCGAGATCAGG - Intergenic
1203217590 22_KI270731v1_random:15212-15234 GCTTGCGGTGAGCCGAGATCAGG - Intergenic
950289995 3:11776074-11776096 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
951731275 3:25813088-25813110 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
953334023 3:42078688-42078710 GCTTGCAGTGAGCCAAGATCAGG + Intronic
953589849 3:44241477-44241499 GCTTGTGAGGAGCGATGAGCTGG + Intergenic
954252190 3:49376578-49376600 GCTTGCAGTGAGCCAAGATCGGG + Intronic
954276689 3:49546777-49546799 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
955158745 3:56444023-56444045 GCTTGCAGTGAGCCAAGATCAGG - Intronic
957331779 3:78774371-78774393 GCTTGCGGTGAGCCGAGATCCGG - Intronic
959530832 3:107431865-107431887 GCTTGCCGGGAGCCCAGGGCTGG - Intergenic
959999312 3:112714140-112714162 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
960570356 3:119179570-119179592 GCTTGCAGTGAGCCAAGATCAGG - Intronic
960644607 3:119865530-119865552 GCTTGCAGTGAGCCAAGATCGGG - Intronic
961486973 3:127223445-127223467 GCTTGAGGGGAGAGAGGAGCTGG + Intergenic
961625261 3:128257858-128257880 GCATGCTAGGAGCCAGGAGCAGG + Intronic
962600260 3:136986148-136986170 GCTTGCAGTGAGCCAAGATCGGG + Intronic
963061741 3:141231847-141231869 GCTGGCGGCGAGCGCCGAGCCGG + Exonic
964303851 3:155319793-155319815 GGTTGCTGGGAGCCAGGAGGTGG - Intergenic
967580485 3:191147132-191147154 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
968334551 3:197901749-197901771 GCTGTCTGGGAGCCAAGAGCTGG - Intronic
968466791 4:755973-755995 GGTTGCGGTGAGCCAAGATCAGG - Intronic
968573227 4:1353352-1353374 GTTTGTGCGGAGCCACGGGCTGG + Exonic
970036370 4:11739876-11739898 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
971176239 4:24284963-24284985 GGTTGCAGTGAGCCACGATCGGG + Intergenic
974387076 4:61215612-61215634 GCTTGCAGGGAGCCGAGATCGGG - Intronic
979021091 4:115499078-115499100 GGTTGCAGGGAGCCAAGATCGGG + Intergenic
980874008 4:138642392-138642414 GATTGCGGTGAGCCAAGATCGGG - Intergenic
981254456 4:142644841-142644863 GCTTGCAGTGAGCCAAGATCAGG + Intronic
981416615 4:144500929-144500951 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
982932911 4:161430675-161430697 GCTTGCAGTGAGCCAAGATCCGG + Intronic
984889876 4:184482471-184482493 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
985060119 4:186069662-186069684 GCTGGAGGGGAGACAGGAGCTGG + Intronic
985854344 5:2413311-2413333 GCTTTCATGGAGCCAGGAGCAGG + Intergenic
986816534 5:11418341-11418363 GGTTGCGGTGAGCCAAGATCAGG + Intronic
987079028 5:14409770-14409792 GCTTGCAGTGAGCCAAGATCAGG + Intronic
988878455 5:35474049-35474071 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
990247679 5:53879380-53879402 GCTTGCGGTGAGCCGAGATCGGG + Intergenic
990409487 5:55526867-55526889 GCTTGCAGTGAGCCAAGATCGGG + Intronic
990585022 5:57202349-57202371 GCTTGCAGCGAGCCAAGATCAGG - Intronic
991252337 5:64577377-64577399 GCTTGCAGTGAGCCAAGATCCGG + Intronic
991572478 5:68070002-68070024 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
991728788 5:69562549-69562571 GGTTGCAGTGAGCCACGAGGTGG + Intronic
991805218 5:70417698-70417720 GGTTGCAGTGAGCCACGAGGTGG + Intergenic
991866166 5:71065324-71065346 GGTTGCAGTGAGCCACGAGGTGG - Intronic
992009931 5:72516064-72516086 GCTTGCGGTGAGCCAAGATTGGG - Intergenic
992039293 5:72813789-72813811 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
992446374 5:76837862-76837884 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
992550141 5:77851994-77852016 GGTGGCGGGGAGCCGGGAGCCGG - Intronic
994169697 5:96644911-96644933 GGTTGCGGTGAGCCAAGATCGGG + Intronic
994212707 5:97103900-97103922 GCTTGCAGTGAGCCAAGATCAGG + Intronic
994715859 5:103320964-103320986 GCTTGCAGGGAGCCGAGATCGGG - Intergenic
997561311 5:134848246-134848268 GCTTGCAGTGAGCCAAGATCGGG + Intronic
999339057 5:150752927-150752949 GCTTGCGGTGAGCCGAGATCGGG - Intronic
1001622014 5:173095249-173095271 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1001835963 5:174832730-174832752 GCTTGTGGAGAGCCAGCAGCAGG - Intergenic
1001959539 5:175871918-175871940 CCTTGCGAGGGGCCGCGAGCAGG + Intronic
1002033203 5:176446084-176446106 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1002048480 5:176555501-176555523 GCTGGAGGGGAGGCAAGAGCAGG - Intronic
1002499340 5:179637295-179637317 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1002851930 6:1004007-1004029 TCTTGCGGGGTGCCGGGAGCAGG - Intergenic
1003117673 6:3294014-3294036 CCTTGTGGGGAGCCACGTGCAGG - Intronic
1003569438 6:7246599-7246621 GCGTGGGGAGAGCCATGAGCCGG + Exonic
1003872373 6:10412994-10413016 TTTTGCCGGGAGCCGCGAGCCGG - Intronic
1005045065 6:21634178-21634200 GCTTGCAGTGAGCCAAGATCTGG - Intergenic
1005476578 6:26214161-26214183 GCTTGCCGTGAGCCAAGATCGGG - Intergenic
1005525737 6:26645966-26645988 GGTTGCGGTGAGCCAAGATCAGG + Intronic
1005978895 6:30820955-30820977 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1006364622 6:33608190-33608212 GCTTGCAGGGGGTCAGGAGCTGG + Intergenic
1007407694 6:41644377-41644399 GCTTGCCTGGAGACAGGAGCTGG - Intronic
1007551265 6:42731816-42731838 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1008004771 6:46399643-46399665 GATTGCTGGCAGCCACCAGCAGG - Intronic
1008216788 6:48800818-48800840 GGTTGCATGGAGCCAGGAGCCGG + Intergenic
1009425133 6:63505513-63505535 GGTTGCAGTGAGCCAAGAGCAGG + Intergenic
1009432673 6:63583836-63583858 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
1011555157 6:88565972-88565994 GCATGTGGCAAGCCACGAGCTGG - Intergenic
1013113848 6:107085847-107085869 GCTTGCGGTGAGCCGAGATCGGG - Intronic
1014597189 6:123359756-123359778 GCTTGCGGTGAGCCGAGATCCGG - Intronic
1015303789 6:131683811-131683833 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1015716249 6:136195226-136195248 CTTTGCGGGGAGCCATAAGCAGG - Exonic
1016160933 6:140878634-140878656 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG + Intergenic
1016944296 6:149514382-149514404 GGTTGCAGGGAGCCAAGATCAGG - Intronic
1017430523 6:154366315-154366337 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1017906678 6:158761363-158761385 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1017910989 6:158792750-158792772 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1018240274 6:161767452-161767474 GCTTGCAGTGAGCCAAGATCAGG + Intronic
1019419954 7:946254-946276 GCTGGCGGGGATCCACCGGCCGG - Intronic
1019693588 7:2432077-2432099 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1020557528 7:9689914-9689936 GCTTGCAGTGAGCCGCGATCAGG - Intergenic
1023401147 7:39793571-39793593 GCTTGCTGGGAGGCAGGAGCTGG + Intergenic
1023435130 7:40134469-40134491 GCTTCCGGGGAACCCCGGGCGGG - Exonic
1024074652 7:45812302-45812324 GCTTGCTGGGAGGCAGGAGCTGG + Intergenic
1024300019 7:47879868-47879890 GCTTGCGGTGAGCCAAGATCGGG + Intronic
1024372037 7:48596733-48596755 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1024648466 7:51387110-51387132 GCTTGCTGGGAGGCAGGAGCTGG - Intergenic
1024723039 7:52159670-52159692 GCTTGCAGGGAGCCGAGATCGGG + Intergenic
1025052315 7:55741579-55741601 GCTTGCTGGGAGGCAGGAGCTGG - Intergenic
1025052709 7:55743127-55743149 GCTTGCTGGGAGGCAGGAGCTGG - Intergenic
1025130294 7:56371363-56371385 GCCTGCTGGGAGGCAGGAGCTGG - Intergenic
1025130614 7:56372661-56372683 GCCTGCTGGGAGGCAGGAGCTGG - Intergenic
1025176364 7:56804315-56804337 GCTTGCTGGGAGGCAGGAGCTGG - Intergenic
1025178177 7:56812331-56812353 GCTTGCTGGGAGGCCGGAGCTGG + Intergenic
1025179047 7:56815863-56815885 GCTTGCTGGGAGGCCGGAGCTGG + Intergenic
1025179952 7:56819587-56819609 GCTTGCTGGGAGGCCGGAGCTGG + Intergenic
1025181297 7:56825158-56825180 GCTTGCTGGGAGGCCGGAGCTGG + Intronic
1025181743 7:56826996-56827018 GCTTGCTGGGAGGCCGGAGCTGG + Intronic
1025277656 7:57597607-57597629 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1025690174 7:63749999-63750021 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025690621 7:63751822-63751844 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025691072 7:63753645-63753667 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025691506 7:63755421-63755443 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025691946 7:63757244-63757266 GCTTGCTGGGAGGCCGGAGCTGG - Exonic
1025692395 7:63759067-63759089 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025692839 7:63760890-63760912 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025693255 7:63762569-63762591 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025693698 7:63764392-63764414 GCTTGCTGGGAGGCCGGAGCTGG - Intergenic
1025695430 7:63772107-63772129 GCTTGCTGGGAGGCAGGAGCTGG + Intergenic
1026017847 7:66684695-66684717 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1027343984 7:77238477-77238499 GCTTGCAGTGAGCCAAGACCAGG - Intronic
1027664210 7:81024172-81024194 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1031802112 7:126259690-126259712 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1032322994 7:130901341-130901363 GCCTGCGGGGAGCAGGGAGCAGG - Intergenic
1032542220 7:132712622-132712644 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1032710827 7:134458865-134458887 GCGTGCTGGGAGCCACGCGCGGG - Intronic
1033198131 7:139344763-139344785 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1034544831 7:151782923-151782945 GCTCGCGGGGAGCCAGGACCAGG + Intronic
1037758498 8:21726813-21726835 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1037860546 8:22402320-22402342 GCTTGCAGTGAGCCAAGATCTGG + Intronic
1038487671 8:27948406-27948428 CCTGGCTGGGAGCCACGAGCTGG + Intronic
1039522235 8:38181001-38181023 GCTTGCGGTGAGCCGAGATCAGG - Intronic
1043621442 8:82197586-82197608 GCTTGCGGTGAGCCAAGATCAGG + Intergenic
1044242414 8:89902572-89902594 GCCTGCAGGGAGCCAGGCGCCGG - Exonic
1044367679 8:91368479-91368501 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1044637949 8:94345810-94345832 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
1044653591 8:94524365-94524387 GCATGCGGTGAGCCAAGATCTGG - Intronic
1045020248 8:98036919-98036941 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1046618297 8:116501151-116501173 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1046679269 8:117150666-117150688 GCTTGCAGTGAGCCAAGATCGGG - Intronic
1047637684 8:126782618-126782640 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1047683008 8:127274281-127274303 GCTTGCAGGGAGCCACAAAATGG + Intergenic
1048887700 8:138921942-138921964 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1049055152 8:140230547-140230569 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1049336085 8:142086578-142086600 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1050680023 9:8100326-8100348 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1050813179 9:9775891-9775913 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1052182178 9:25543448-25543470 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1053549315 9:39058647-39058669 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1053813437 9:41878718-41878740 GCTTGCAGTGAGCCAGGATCAGG + Intergenic
1054318383 9:63624151-63624173 GCTTGCAGGGAGCCGAGATCGGG + Intergenic
1054354493 9:64048524-64048546 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1054617159 9:67308721-67308743 GCTTGCAGTGAGCCAGGATCAGG - Intergenic
1057243621 9:93435176-93435198 GCTTGCAGTGAGCCAAGATCGGG - Intergenic
1057548402 9:96034822-96034844 TCTTGGAGGGAGCCAGGAGCAGG + Intergenic
1058455643 9:105135571-105135593 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1058734980 9:107885814-107885836 GCTTGCAGTGAGCCAAGATCCGG + Intergenic
1059426181 9:114222327-114222349 GCGTGTGGGGAGCCAGGAGCAGG + Intronic
1060388666 9:123258736-123258758 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1060722151 9:125986487-125986509 CCCTGCGGGGAGCCACCTGCAGG - Intergenic
1061112952 9:128588372-128588394 GGTTGCGGTGAGCCAAGATCAGG - Intronic
1061159513 9:128885087-128885109 GGTTTCGGGGAGCCAGGAGCTGG - Intronic
1061265504 9:129502645-129502667 GCTTGCGGTGAGCCGAGATCGGG - Intergenic
1061312234 9:129771340-129771362 GGTTGCGGTGAGCCAAGATCAGG - Intergenic
1061517308 9:131097138-131097160 GCTTGCGGGGAGCCACGAGCCGG - Intronic
1061786238 9:133030341-133030363 GCTTGCGGGGGGCCTCGCGGAGG - Intergenic
1061847139 9:133394181-133394203 GCTTGCGGGGGGCCACCAAAGGG + Intronic
1062191704 9:135251217-135251239 GCTTGCGGGGAGCTACTTGCGGG - Intergenic
1202785400 9_KI270719v1_random:10824-10846 GCTTGCAGTGAGCCAAGATCAGG + Intergenic
1203742828 Un_GL000218v1:17648-17670 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1186660832 X:11665805-11665827 GCTGGGGCGGAGCCAGGAGCAGG + Intergenic
1189791964 X:44613059-44613081 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
1190313844 X:49136821-49136843 GCTTGCAGTGAGCCAGGATCGGG + Intergenic
1192420042 X:71021510-71021532 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1195218198 X:102721220-102721242 GCTTCAGGGGAGCCCAGAGCGGG + Intronic
1195950956 X:110272151-110272173 GCTTGCAGTGAGCCAAGATCGGG + Intronic
1196437999 X:115692332-115692354 GGTTGCAGTGAGCCACGATCAGG - Intergenic
1197190343 X:123640122-123640144 GGTTGCGGTGAGCCAAGATCGGG + Intronic
1197492953 X:127140776-127140798 GCTTGCAGTGAGCCAAGATCGGG + Intergenic
1197931546 X:131701147-131701169 GGTTGCGGTGAGCCAAGATCAGG + Intergenic
1201156359 Y:11135117-11135139 GCTTGCAGTGAGCCAAGATCAGG - Intergenic
1201324959 Y:12746794-12746816 GCTTGCAGTGAGCCAAGATCAGG - Intronic
1201948570 Y:19538643-19538665 GCTTCTGGGGAGCCAAGATCAGG + Intergenic
1202083526 Y:21110548-21110570 GCTTTCGGTGAGCCAAGATCAGG - Intergenic
1202380937 Y:24276313-24276335 GTTTGCTGGGAGGCAGGAGCTGG + Intergenic
1202489848 Y:25393813-25393835 GTTTGCTGGGAGGCAGGAGCTGG - Intergenic