ID: 1061517375

View in Genome Browser
Species Human (GRCh38)
Location 9:131097469-131097491
Sequence GTTTGAGGGAGGCGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061517375_1061517383 7 Left 1061517375 9:131097469-131097491 CCAGCCTCCCGCCTCCCTCAAAC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517375_1061517386 23 Left 1061517375 9:131097469-131097491 CCAGCCTCCCGCCTCCCTCAAAC No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517375_1061517387 24 Left 1061517375 9:131097469-131097491 CCAGCCTCCCGCCTCCCTCAAAC No data
Right 1061517387 9:131097516-131097538 TTCAGGAAAGATTGCCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061517375 Original CRISPR GTTTGAGGGAGGCGGGAGGC TGG (reversed) Intronic