ID: 1061517383

View in Genome Browser
Species Human (GRCh38)
Location 9:131097499-131097521
Sequence TCCTCTTCACTCCAACTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061517377_1061517383 0 Left 1061517377 9:131097476-131097498 CCCGCCTCCCTCAAACACACCAC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517381_1061517383 -8 Left 1061517381 9:131097484-131097506 CCTCAAACACACCACTCCTCTTC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517379_1061517383 -4 Left 1061517379 9:131097480-131097502 CCTCCCTCAAACACACCACTCCT No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517375_1061517383 7 Left 1061517375 9:131097469-131097491 CCAGCCTCCCGCCTCCCTCAAAC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517371_1061517383 28 Left 1061517371 9:131097448-131097470 CCTGGCACTTCCCCGTGGTCTCC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517373_1061517383 17 Left 1061517373 9:131097459-131097481 CCCGTGGTCTCCAGCCTCCCGCC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517378_1061517383 -1 Left 1061517378 9:131097477-131097499 CCGCCTCCCTCAAACACACCACT No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517374_1061517383 16 Left 1061517374 9:131097460-131097482 CCGTGGTCTCCAGCCTCCCGCCT No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517380_1061517383 -7 Left 1061517380 9:131097483-131097505 CCCTCAAACACACCACTCCTCTT No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517376_1061517383 3 Left 1061517376 9:131097473-131097495 CCTCCCGCCTCCCTCAAACACAC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data
1061517372_1061517383 18 Left 1061517372 9:131097458-131097480 CCCCGTGGTCTCCAGCCTCCCGC No data
Right 1061517383 9:131097499-131097521 TCCTCTTCACTCCAACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061517383 Original CRISPR TCCTCTTCACTCCAACTTTC AGG Intronic