ID: 1061517386

View in Genome Browser
Species Human (GRCh38)
Location 9:131097515-131097537
Sequence TTTCAGGAAAGATTGCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061517380_1061517386 9 Left 1061517380 9:131097483-131097505 CCCTCAAACACACCACTCCTCTT No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517378_1061517386 15 Left 1061517378 9:131097477-131097499 CCGCCTCCCTCAAACACACCACT No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517381_1061517386 8 Left 1061517381 9:131097484-131097506 CCTCAAACACACCACTCCTCTTC No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517377_1061517386 16 Left 1061517377 9:131097476-131097498 CCCGCCTCCCTCAAACACACCAC No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517379_1061517386 12 Left 1061517379 9:131097480-131097502 CCTCCCTCAAACACACCACTCCT No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517376_1061517386 19 Left 1061517376 9:131097473-131097495 CCTCCCGCCTCCCTCAAACACAC No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517382_1061517386 -3 Left 1061517382 9:131097495-131097517 CCACTCCTCTTCACTCCAACTTT No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517375_1061517386 23 Left 1061517375 9:131097469-131097491 CCAGCCTCCCGCCTCCCTCAAAC No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data
1061517384_1061517386 -8 Left 1061517384 9:131097500-131097522 CCTCTTCACTCCAACTTTCAGGA No data
Right 1061517386 9:131097515-131097537 TTTCAGGAAAGATTGCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061517386 Original CRISPR TTTCAGGAAAGATTGCCTTA AGG Intronic