ID: 1061522860

View in Genome Browser
Species Human (GRCh38)
Location 9:131131407-131131429
Sequence GTCCAGGCTCAATAGACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061522860_1061522866 0 Left 1061522860 9:131131407-131131429 CCATATGTCTATTGAGCCTGGAC No data
Right 1061522866 9:131131430-131131452 ACGAAGGAGGGATTCACAGGTGG No data
1061522860_1061522867 8 Left 1061522860 9:131131407-131131429 CCATATGTCTATTGAGCCTGGAC No data
Right 1061522867 9:131131438-131131460 GGGATTCACAGGTGGTGCTAAGG No data
1061522860_1061522865 -3 Left 1061522860 9:131131407-131131429 CCATATGTCTATTGAGCCTGGAC No data
Right 1061522865 9:131131427-131131449 GACACGAAGGAGGGATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061522860 Original CRISPR GTCCAGGCTCAATAGACATA TGG (reversed) Intronic