ID: 1061527744

View in Genome Browser
Species Human (GRCh38)
Location 9:131181274-131181296
Sequence GGGAACAAGAGGAAGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061527741_1061527744 -3 Left 1061527741 9:131181254-131181276 CCTCTGGTGACGAGAGTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061527744 Original CRISPR GGGAACAAGAGGAAGAATGC TGG Intronic
No off target data available for this crispr