ID: 1061530263

View in Genome Browser
Species Human (GRCh38)
Location 9:131206303-131206325
Sequence AAAAATACAAAAAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061530263_1061530266 -9 Left 1061530263 9:131206303-131206325 CCTGGCTAATTTTTTGTATTTTT No data
Right 1061530266 9:131206317-131206339 TGTATTTTTTTGTAGAGACGGGG No data
1061530263_1061530271 27 Left 1061530263 9:131206303-131206325 CCTGGCTAATTTTTTGTATTTTT No data
Right 1061530271 9:131206353-131206375 CCAGGCTGGTCTTGAACTCCTGG No data
1061530263_1061530267 9 Left 1061530263 9:131206303-131206325 CCTGGCTAATTTTTTGTATTTTT No data
Right 1061530267 9:131206335-131206357 CGGGGTTTCACATGTTGCCCAGG No data
1061530263_1061530272 28 Left 1061530263 9:131206303-131206325 CCTGGCTAATTTTTTGTATTTTT No data
Right 1061530272 9:131206354-131206376 CAGGCTGGTCTTGAACTCCTGGG No data
1061530263_1061530268 13 Left 1061530263 9:131206303-131206325 CCTGGCTAATTTTTTGTATTTTT No data
Right 1061530268 9:131206339-131206361 GTTTCACATGTTGCCCAGGCTGG No data
1061530263_1061530265 -10 Left 1061530263 9:131206303-131206325 CCTGGCTAATTTTTTGTATTTTT No data
Right 1061530265 9:131206316-131206338 TTGTATTTTTTTGTAGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061530263 Original CRISPR AAAAATACAAAAAATTAGCC AGG (reversed) Intronic