ID: 1061530267

View in Genome Browser
Species Human (GRCh38)
Location 9:131206335-131206357
Sequence CGGGGTTTCACATGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061530263_1061530267 9 Left 1061530263 9:131206303-131206325 CCTGGCTAATTTTTTGTATTTTT No data
Right 1061530267 9:131206335-131206357 CGGGGTTTCACATGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061530267 Original CRISPR CGGGGTTTCACATGTTGCCC AGG Intronic