ID: 1061531603

View in Genome Browser
Species Human (GRCh38)
Location 9:131218497-131218519
Sequence TTTGAAAGGCAGAAGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 8, 3: 52, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061531603 Original CRISPR TTTGAAAGGCAGAAGGAACC AGG (reversed) Intronic
902184112 1:14712234-14712256 TTAGAAGGGCAGAAGGAGCAGGG + Intronic
903247944 1:22030171-22030193 ATTGGAAGGCTGATGGAACCTGG + Intergenic
903375585 1:22863753-22863775 TCTGAATGGCAGAAAGAGCCAGG - Intronic
903659850 1:24970331-24970353 TTTAAGAGGCAGATGGAATCGGG + Intergenic
905615479 1:39394681-39394703 TTTGAAAGGAAGGAGTAAACTGG - Intronic
905912828 1:41665320-41665342 TCTGAAAGGCAGGTGGTACCAGG + Intronic
906535058 1:46546907-46546929 TTTGATAGGCAGACAGAAGCAGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908137862 1:61151517-61151539 TTAGAAAGGGAGAAGAAATCAGG + Intronic
908280326 1:62527193-62527215 TCTTAAAGGCAGAAGGATCAGGG - Intronic
908530291 1:65027562-65027584 TGTGAAAGGCAAAAGGAAGAGGG + Intergenic
908555024 1:65249063-65249085 TATGAAATGAAGAAGGAAACTGG - Intronic
909873096 1:80768482-80768504 TTTAAAAGGCAGAAGGCAAATGG - Intergenic
910272140 1:85408167-85408189 TGTGAAGGGCAAAAGAAACCAGG - Intronic
910294498 1:85630775-85630797 TTTGAAAGGTAGAATTAAGCTGG - Intergenic
910568060 1:88667548-88667570 GTGGAAAGACAGAAAGAACCTGG - Intergenic
910586923 1:88890972-88890994 TTGGTAAGCCAGATGGAACCTGG - Intronic
912417598 1:109520637-109520659 GTTGAAAGGCAGAAGGCAGGAGG - Intergenic
912436140 1:109662338-109662360 TGTGGAAGACAGAAGGATCCTGG - Intronic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
916366844 1:164038684-164038706 TTTTAAAGGCATAAGAAAGCAGG - Intergenic
917955426 1:180091586-180091608 TTTGAAAGGCTGAAGTAGGCAGG + Intronic
918293025 1:183127721-183127743 TGTTCCAGGCAGAAGGAACCTGG + Intronic
918702501 1:187622531-187622553 TTAGAAAGGCACATGAAACCTGG + Intergenic
919862313 1:201748407-201748429 TTAGAAAGGGAGATGGAATCTGG + Intronic
922220061 1:223551575-223551597 TGTGAAAGGCAGCAGGACCCTGG - Intronic
922577518 1:226672450-226672472 TTTCAAAGGCAAAAGGAACAAGG - Intronic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
923328473 1:232900910-232900932 TTGGAAAGCAAGAAGGAAGCAGG + Intergenic
923330963 1:232924299-232924321 TCAGAAAGGCAGGAGGAGCCAGG + Intergenic
923389446 1:233499417-233499439 ACAGAAAGGCAGAAGGAACCTGG + Intergenic
924037436 1:239951656-239951678 TGTGAAAGGCAGAAGGTCCTTGG + Intergenic
924244923 1:242074687-242074709 TATGAAAGGGAGAAAGATCCAGG + Intergenic
924513580 1:244748365-244748387 TTTTAAAGGCAAAAGGAACAAGG + Intergenic
924743239 1:246809894-246809916 ATTGAAAGGCTGATGGAACAAGG - Intergenic
924927068 1:248693320-248693342 TTTGAGAGGCTGAGGGAACCAGG - Intergenic
1063499309 10:6538541-6538563 TTCTAAAGGCAGGAGGAGCCAGG - Intronic
1064126031 10:12661068-12661090 GTTGAAAAGCAGAAGGAATAGGG - Intronic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065288296 10:24206221-24206243 TGTGAAAGGCATAAGGAAAGCGG - Intronic
1065394458 10:25218953-25218975 TTTGAAAGGCATCAGTAAGCAGG - Intronic
1065445452 10:25793960-25793982 TTTTAAAGGCAAAGGGAACAAGG + Intergenic
1065551011 10:26868618-26868640 TTGGAAGGACAGCAGGAACCTGG + Intergenic
1066663669 10:37761051-37761073 TTTGAAAGGCAGATGGAGTTGGG - Intergenic
1067489260 10:46682575-46682597 TTGGAAAGCCAGAAGGAAACTGG + Intergenic
1067605411 10:47657810-47657832 TTGGAAAGCCAGAAGGAAACTGG - Intergenic
1067699571 10:48559176-48559198 TTTGTATCTCAGAAGGAACCAGG + Intronic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070286102 10:75085108-75085130 ACTGAAAGGTAGAAAGAACCGGG - Intergenic
1070631433 10:78087764-78087786 TCTGAAAGACAGAAGGGATCTGG - Intergenic
1071439719 10:85679588-85679610 TTTTCCAGGCAGAAGGAACAAGG + Intronic
1071620970 10:87119205-87119227 TTGGAAAGCCAGAAGGAAACTGG - Intronic
1071748702 10:88450943-88450965 TTTAAAAGGCAGGAAGAACTTGG + Intronic
1071888038 10:89972007-89972029 TTTCAAAGGCAGAAGGATTGTGG + Intergenic
1071982871 10:91021588-91021610 TTTGAAAGAGAACAGGAACCTGG + Intergenic
1072988329 10:100164496-100164518 TTTGACATGCAGAATGAAGCTGG + Intronic
1073596351 10:104804230-104804252 TTTGCAAAGATGAAGGAACCTGG + Intronic
1073666942 10:105544154-105544176 TTTGAAAGGCAGAAGGTAGGAGG - Intergenic
1073729123 10:106269605-106269627 TTTGAAAGAGAGAGGGAACTAGG - Intergenic
1075063757 10:119274946-119274968 TTTGCAAAGCAGTAAGAACCTGG + Intronic
1075317474 10:121464554-121464576 TTTGGAAAGCAGAGGCAACCTGG + Intergenic
1075420989 10:122300023-122300045 TCTGTAAGGGAGAAGGAGCCTGG - Intronic
1077245956 11:1538423-1538445 GCAGAAAGGCAGAAAGAACCTGG + Intergenic
1078531993 11:12143832-12143854 TTTGCAAGGCAAAAGTATCCAGG + Intronic
1078822844 11:14899349-14899371 CATGACAGGCAGAATGAACCTGG + Intergenic
1080217153 11:29857106-29857128 TTTGGAAGCCAGAAGGAAGTGGG + Intergenic
1080249559 11:30217931-30217953 TTTTAAAAGCAAAAAGAACCAGG - Intergenic
1080291199 11:30673676-30673698 TTGGAAATGCAGAAGTTACCCGG - Intergenic
1080396226 11:31892769-31892791 TTTGATGGGGAGAAGGAAGCAGG - Intronic
1080999128 11:37645719-37645741 TTTGAATGGGAAAAGGAACTTGG - Intergenic
1081625330 11:44652011-44652033 TTTGCAAGGAAGAAGGAAGGGGG + Intergenic
1081989397 11:47329652-47329674 TTGGGAATGCAGAAGGAAGCAGG - Exonic
1082645865 11:55724204-55724226 TTTGAAAGGGAGAAGGAATCAGG - Intergenic
1083847510 11:65344676-65344698 TGAGAAAGGCAGGAGGAACAAGG - Intronic
1084486774 11:69452852-69452874 GTGGAGAGGTAGAAGGAACCTGG + Intergenic
1086155825 11:83664739-83664761 TTTCAAAGGTAAAATGAACCTGG - Intronic
1086472283 11:87127473-87127495 TTAGAATGGGAGAAAGAACCTGG - Intronic
1086848929 11:91785457-91785479 TTAGAAAAGCAGAAGGTAGCTGG - Intergenic
1088587569 11:111373007-111373029 TTAGAAAGGAAAAAGGAGCCTGG + Intronic
1089485268 11:118840830-118840852 TTAGAAACTAAGAAGGAACCGGG + Intergenic
1090015359 11:123081305-123081327 GTTGAAAGACAAAAGGAAGCAGG - Intronic
1090193348 11:124792939-124792961 TTAGAAAGCCAGAGGGAAACAGG - Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091009875 11:131990552-131990574 TGTGTAAGACTGAAGGAACCTGG - Intronic
1091750873 12:3020601-3020623 TGAGAAAGGCACATGGAACCTGG - Intronic
1092158127 12:6298107-6298129 TTTGAAAGGCAGAGATAACGTGG - Intergenic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1093469799 12:19488472-19488494 TTTCAGAGGCAGAAAGAATCCGG + Intronic
1093591093 12:20903706-20903728 GTTGAATTGGAGAAGGAACCTGG - Intronic
1095343146 12:41116543-41116565 TTCACATGGCAGAAGGAACCAGG - Intergenic
1095972000 12:47908478-47908500 TTAGAAAGACAGAAGGGACCAGG + Intronic
1096012381 12:48230831-48230853 TTTGAAAGCCAGAAAGAAGTAGG + Intergenic
1097599940 12:61678510-61678532 TTTGAAAGTCATAAGAATCCAGG + Intergenic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1097751996 12:63365834-63365856 CCTGAAAGGCAGCAGGAAACAGG - Intergenic
1099579930 12:84432839-84432861 GATGAAAGGCAGAATCAACCAGG - Intergenic
1099770850 12:87053554-87053576 TTTAAAAATCAGAAGAAACCAGG + Intergenic
1100069289 12:90691784-90691806 TTTTAAAGGCAAAGGGAATCGGG + Intergenic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1101147859 12:101858226-101858248 TTTGAAAGGCTCAATGAACTGGG - Intergenic
1102823599 12:115927804-115927826 CTTGGATGGCAGAATGAACCTGG - Intergenic
1103238434 12:119394361-119394383 TGTAACAGGCAGAAGGAACTAGG - Intronic
1104999575 12:132681172-132681194 TTTGAGCGGCTGAAGGAGCCTGG - Exonic
1105906805 13:24820069-24820091 TTTGGAAGCCAGAAGGAAATGGG - Intronic
1106022692 13:25930233-25930255 TTTGAAAGAGAGAAGGAACATGG - Intronic
1106259496 13:28053087-28053109 TTAGAAAGACAGAAGAAACATGG + Intronic
1106749332 13:32743609-32743631 ATGGAAAGGCAGAAGGCAGCTGG - Intronic
1107371141 13:39749809-39749831 TTTGAATGGTAGAAGGAATTTGG + Intronic
1107429215 13:40323923-40323945 CTTGAAAGGCAGAAATTACCAGG - Intergenic
1110281579 13:73699768-73699790 TTTTAAAGGCAGAAGCAGCAGGG + Intronic
1111612732 13:90624449-90624471 TTTGGAAGGCAGAATTAACTGGG + Intergenic
1111880133 13:93945555-93945577 TTTGCAACTCAGGAGGAACCAGG - Intronic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1112212332 13:97390577-97390599 TTTGCAAAGGAGAAGGAACTTGG - Intronic
1112745076 13:102518392-102518414 TTTGAATGCCAGAATAAACCTGG + Intergenic
1112772920 13:102811400-102811422 TTTGGAAGCCAGAAGGAAGTGGG - Intronic
1112845578 13:103638849-103638871 TTTGAAAGACAGAAGGAAAATGG - Intergenic
1112886296 13:104176764-104176786 TGTGACAGTCAGAAGGCACCTGG - Intergenic
1113361718 13:109637776-109637798 TTTCAAAGCCAAAAGGAACATGG - Intergenic
1113477791 13:110597494-110597516 TTTGAAAGGCAGAAGCACAAAGG - Intergenic
1113698139 13:112363275-112363297 TTTAAAAGGCAGAAAGAACCTGG - Intergenic
1118702097 14:68443407-68443429 CTTCCAGGGCAGAAGGAACCTGG + Intronic
1118704038 14:68463201-68463223 TTTGAATGGCAGAAGGGTCATGG + Intronic
1118734440 14:68691480-68691502 TTTGAAATGCAGAAGCAGCTTGG - Intronic
1118755274 14:68838603-68838625 TTTGAAATCCAGCAGGAAGCTGG - Intergenic
1118911610 14:70066484-70066506 TCTTAAAGGCAGAAGGAAGGGGG - Intronic
1118963271 14:70555795-70555817 TTTGAAAGGGAGAAGTAAGAGGG - Intergenic
1118975671 14:70674076-70674098 TTTGGTAGGGAGAATGAACCTGG - Exonic
1119033057 14:71207413-71207435 GTTGAGAGCCAGAAGGAACCAGG - Intergenic
1119222315 14:72918951-72918973 ATTCAAATGCAGAAGAAACCAGG + Intergenic
1120174286 14:81277033-81277055 TTTGAAAGCCAAAGTGAACCGGG - Exonic
1120191031 14:81439489-81439511 TTTGGAATGCAAAAGGAAACTGG - Intergenic
1121551948 14:94809620-94809642 TTTGAACAGCAGCATGAACCTGG + Intergenic
1123907000 15:24931429-24931451 TTTTAAAGGAAGAATGAAGCTGG + Intronic
1125103789 15:35947163-35947185 TTTTAGAGCCAGAAGGACCCTGG - Intergenic
1126297693 15:47159435-47159457 ATTGAAAGGCAGAAAGAAAAAGG + Intergenic
1126322556 15:47440992-47441014 TTTCAAAGGCAAAAGGAAGAAGG - Intronic
1126786004 15:52178503-52178525 GAAGAAAGGCAGAAGGAGCCTGG + Intronic
1127066528 15:55245406-55245428 TTTGAAAAGTAGAAGGAAACAGG + Intronic
1127102450 15:55581285-55581307 TTTTAAAGGCAGGAGAGACCAGG + Intronic
1127513162 15:59664293-59664315 TTTTAAAGGCAGGAGGACACTGG + Intronic
1127702474 15:61514623-61514645 TTTGAAAGGGAGAAGGCATCAGG + Intergenic
1128610116 15:69066502-69066524 TTTGCAAGGGAGAAGGAAATTGG - Intergenic
1128661334 15:69503135-69503157 TTTGTAAGTCAGAAAGAACCGGG + Intergenic
1128671107 15:69575408-69575430 TTTAACAGGCAGCAGGAAACTGG + Intergenic
1128792769 15:70445191-70445213 TTTGAAAGGCAGAAAGGTCAAGG - Intergenic
1129828373 15:78650623-78650645 TTTGGAAGGCAGAAGGAAAGAGG + Intronic
1130039785 15:80396672-80396694 TTTGAAAGTCAGAAGGTGCTGGG + Intronic
1130234383 15:82120701-82120723 TCAGAAAGACAGAAAGAACCTGG + Intergenic
1130307203 15:82721275-82721297 GTTGAAAGGCAGAAGGAAAAGGG - Intergenic
1131258803 15:90877960-90877982 TTTGAAAGGCAGAGGCAAACAGG + Intronic
1131595156 15:93790990-93791012 TTTGTAAGGCATAAGGAAATAGG + Intergenic
1131942881 15:97585951-97585973 TTTTAAAGTCAGAAAAAACCTGG + Intergenic
1132509183 16:328766-328788 TTTGAAAGGCACATGGCAACGGG + Intronic
1133175453 16:4010910-4010932 TCTGGAAGGGAGAAGGAAACTGG - Intronic
1133436807 16:5786837-5786859 TCTGAAAGGTAGAATGAAGCCGG + Intergenic
1133475484 16:6117344-6117366 TTTGAAATGCATAATGAACTTGG - Intronic
1134117415 16:11559678-11559700 TTTGAAAGGTACAAAGAAACAGG - Intronic
1134118963 16:11570371-11570393 TGTGAGAGGCAGGAGGACCCAGG + Intronic
1134438372 16:14282309-14282331 TGTGGAAGGCAGCAGGCACCAGG + Intergenic
1135627138 16:24005853-24005875 TATGTAAGACAGAAGAAACCAGG - Intronic
1135783138 16:25323926-25323948 TTTGGCAGGCAGAGGGGACCAGG + Intergenic
1135877934 16:26221700-26221722 TTTGGAAGTCAGACAGAACCTGG - Intergenic
1136924209 16:34356432-34356454 TTTGAAAGGCAGAAAAATCAAGG + Intergenic
1136980364 16:35055374-35055396 TTTGAAAGGCAGAAAAATCAAGG - Intergenic
1138564120 16:57820153-57820175 TTTTAAAGTCAGAAGGTAGCCGG - Intronic
1139102552 16:63786217-63786239 TTTGAAAGGCATCATGAACCTGG + Intergenic
1139878351 16:70164288-70164310 TTTGAAAGACAGGAGGGGCCAGG - Intergenic
1142604114 17:1072333-1072355 TTGGAGAGGCAGGAGGCACCCGG + Intronic
1142962473 17:3559303-3559325 TATGAGAGGCAGCAGGAGCCAGG + Intergenic
1143540729 17:7567088-7567110 TTTGAAAGACTGAATGAACACGG - Intronic
1144101226 17:11943976-11943998 TTTGAAAGGCTTATGGAACTTGG + Intronic
1144238781 17:13288799-13288821 TTTTAAAGGCAAAGGGAACAAGG + Intergenic
1146481986 17:33212191-33212213 CTTATAAGGCAAAAGGAACCTGG + Intronic
1150068010 17:62127745-62127767 TTTGTAAGACAGAAGGAACCCGG + Intergenic
1150850459 17:68699171-68699193 TTTGTAGGGGAGAAGGAACTGGG + Intergenic
1151938153 17:77276346-77276368 TATTATAGGCAGAAGGAGCCAGG + Intergenic
1154029025 18:10734287-10734309 TTTTAAAAGCAGAAGGAACCTGG + Intronic
1155348702 18:24884600-24884622 TTTGTAAGGCAGAGGGCTCCTGG + Intergenic
1156066103 18:33145209-33145231 TTTGATTGGTAAAAGGAACCAGG - Intronic
1156347225 18:36268818-36268840 AGTCAAAGGCAGAAGGAAGCAGG - Exonic
1157678619 18:49586496-49586518 TTGGATAGACAGAAGGAAGCAGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159430933 18:68352176-68352198 TTTGAAAAACAGAAGAAAACAGG + Intergenic
1159750237 18:72291968-72291990 TGTGAAATGCAGAAGGAACCTGG - Intergenic
1159769691 18:72535283-72535305 TTTGAAAGCTGGAAGGCACCAGG - Intergenic
1160193708 18:76736093-76736115 TTTGAGAGGCAGCAAGAACGTGG + Intergenic
1160387088 18:78503357-78503379 TGTGGGAGGGAGAAGGAACCAGG - Intergenic
1163041244 19:14604209-14604231 TCTAAAAAGCAGAAGGGACCTGG - Intronic
1163685220 19:18708682-18708704 TTTGAGAGGCAGACGGAGCGTGG + Intronic
1165698182 19:37917027-37917049 TTTGAAAAGTAAAAGGAAGCAGG + Intronic
1167837162 19:52083258-52083280 TGTGACAGGGAAAAGGAACCTGG + Intronic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
926220897 2:10934865-10934887 TTTGACAGGCAACAGGAGCCAGG - Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
928400656 2:30976371-30976393 TTAGAAAAACAGAAGGATCCTGG - Intronic
928946780 2:36778842-36778864 TCTGAAAGGCAGCAGGCATCTGG - Intronic
930860598 2:56068886-56068908 TTTGCAAGCCAGAAGGAAGTGGG - Intergenic
931668148 2:64624811-64624833 TGTGCAAGGCAGCTGGAACCTGG - Intergenic
931799324 2:65743083-65743105 TTGGAAAGGCATAAGGAATCTGG - Intergenic
932111967 2:69010156-69010178 CTTGGAAGGCATTAGGAACCAGG + Intergenic
932455338 2:71845964-71845986 TGTGAAAGGGATAAGGAGCCTGG + Intergenic
932547282 2:72726778-72726800 TTGTAAAGATAGAAGGAACCAGG + Intronic
933477732 2:82814095-82814117 TTTGAAAAGCATAAGGAATCTGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
934604305 2:95682590-95682612 TGAGAAAGGGAGAAGGAGCCAGG - Intergenic
935212892 2:100953745-100953767 TGTGAAAGGCAGCAGGCACTGGG - Intronic
935684130 2:105668730-105668752 TGTGAAAGGAAGAAGGCTCCAGG + Intergenic
935802892 2:106716327-106716349 TGTGAAGAGCAGAAGGACCCAGG - Intergenic
936537700 2:113324820-113324842 TGAGAAAGGGAGAAGGAGCCAGG - Intergenic
936687072 2:114840273-114840295 TTTGAAAGGAAGAAGGAGTAAGG + Intronic
938115449 2:128600157-128600179 TTTTAAGGGCAGAAGGAAGGAGG + Intergenic
938717007 2:134030013-134030035 TTTGAAAGACTGAAGGCACTGGG + Intergenic
938918577 2:135970078-135970100 TTTAAAAGGCAAAAGCAAGCTGG + Intronic
939491834 2:142885656-142885678 TTTGAAAAGCAGAAGATCCCTGG + Intronic
939639085 2:144617670-144617692 TGTTAAAGGCAGCAGGAACTTGG - Intergenic
939652003 2:144775043-144775065 TTTGAAAGGGAAAAGGAAAGTGG + Intergenic
940021586 2:149161649-149161671 TTTGACAGGCAGAAGGCCTCTGG - Intronic
940840281 2:158571917-158571939 TCTGAAAGCCAGAAGGAAGATGG + Intronic
942176808 2:173342515-173342537 TTTGAAAGGCTTAAGGAATTTGG - Intergenic
942260363 2:174154960-174154982 TTTGAAAGGCAGAAGTAAGAAGG - Intronic
942932376 2:181511014-181511036 CTAGAAAGTCAGAAGGAGCCAGG - Intronic
943815489 2:192249234-192249256 TTTGGAAGGTAGAGGGAACACGG - Intergenic
943901378 2:193442075-193442097 GGAGAAAGGCAGAAGGAAGCTGG - Intergenic
944392062 2:199228085-199228107 TTAGAAAGGCTGATGGAACTTGG - Intergenic
946821932 2:223639061-223639083 TTTGAAAGGCAGAAGGATGCAGG - Intergenic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
948561031 2:238852106-238852128 TTTGCCAGGCAAAAGGAATCCGG - Intronic
1169760889 20:9092704-9092726 TGAGAAAGACAGAAGGAACCTGG - Intronic
1170077585 20:12436620-12436642 TTGGTAAAGCAGAAGGAATCTGG + Intergenic
1170605421 20:17872099-17872121 TTTGGAGGGAGGAAGGAACCAGG + Intergenic
1170812376 20:19684563-19684585 GGTGAAAGGGAGAAGGAACAGGG - Intronic
1171088368 20:22260795-22260817 TTTGAAAGAAAGCAGGAACAAGG - Intergenic
1171143801 20:22764750-22764772 TGTGAAAGGCTGCAGGAAGCAGG + Intergenic
1172189401 20:33053135-33053157 TTTGAAAGGCAAAAAGAAACAGG - Intergenic
1172767067 20:37356547-37356569 ATGGACAGGCAGAAGGACCCAGG - Intronic
1172829882 20:37824688-37824710 ATAGAATGACAGAAGGAACCTGG - Intronic
1172896498 20:38304102-38304124 GTGGAAAGGAGGAAGGAACCTGG - Exonic
1172943923 20:38673833-38673855 TTTCCAAGGCAGAGGGAATCAGG + Intergenic
1173324719 20:42022251-42022273 TTTGAAGGGGTGAAGGAATCAGG + Intergenic
1173347279 20:42212632-42212654 TTTTACAGGCAGGAGGAAACTGG - Intronic
1173955592 20:47030185-47030207 TTTGAAAGTCAGGTGGGACCTGG + Intronic
1174079021 20:47957851-47957873 GCAGAAAGGCAGAAGGAGCCAGG - Intergenic
1174120445 20:48260846-48260868 TTTGCAAGGTAGATGGAACCAGG - Intergenic
1175006508 20:55689231-55689253 GAAGAAAGGCAGAAGGAGCCTGG - Intergenic
1175061368 20:56246957-56246979 TGTGAAAGGCAGAAGTTAGCAGG - Intergenic
1175658073 20:60789377-60789399 GGTGAAAGGCAGAAGGTAGCTGG + Intergenic
1175659862 20:60803448-60803470 TTTGGAAGGCAGATGGACACAGG + Intergenic
1176690156 21:9897297-9897319 TTTGAAAGGCAAGATGAATCTGG - Intergenic
1177226831 21:18268129-18268151 TTTGAAATGCAGAAGAAATGTGG + Intergenic
1178966399 21:37123440-37123462 TTTGAAAGACATCAGGAAGCTGG - Intronic
1179309743 21:40185184-40185206 ATTGAAAGGGAGAAGGAGCTGGG + Intronic
1181617137 22:24062653-24062675 TTTAAAAGTCAGAATGAAGCTGG - Intronic
1181764180 22:25079471-25079493 GGGGAAAGACAGAAGGAACCAGG + Intronic
1182620465 22:31615859-31615881 TTTGACTGGAAGAAGGAACTGGG + Intronic
1183551055 22:38485736-38485758 TTTGGTGGGCAGAAGAAACCTGG + Exonic
1183649053 22:39144034-39144056 GTTAAAAGGCAGAAAGAGCCTGG + Intronic
1184001160 22:41674640-41674662 GTTGAAAGGCAGAAAGAGCCAGG - Exonic
1184888367 22:47362874-47362896 TTTGAAAAACAGAAGGCACTAGG - Intergenic
1184947680 22:47815808-47815830 TTTTAAAGGCAGGAGGCACGGGG - Intergenic
949504477 3:4714189-4714211 TTTCAAGGGCAGAAATAACCCGG + Intronic
949521863 3:4863776-4863798 TTTGAAAGGAAGAATGTACAGGG - Intronic
950706827 3:14788064-14788086 CTTGGAAAGCAGAAGGAACTAGG - Intergenic
951228206 3:20145228-20145250 TTTAAAAGGCAAAAAGAAACAGG - Intronic
951288228 3:20842006-20842028 TTTTAAAGGGAGGGGGAACCGGG - Intergenic
951646495 3:24897489-24897511 TTTGAAAGGAAGAAGTAACTTGG - Intergenic
953708701 3:45251239-45251261 TTTAAAAAGCAAAAGGAAGCAGG + Intergenic
953943928 3:47128892-47128914 TTTTCAAGACAGAAGGTACCAGG + Intronic
954922201 3:54201218-54201240 TTTAAAAGGTAAAAGGAAACAGG - Intronic
955953901 3:64268344-64268366 TTTCAAAAGCAGAAGGACACAGG + Intronic
956644110 3:71439646-71439668 TTTAAAAGGGAGAAGGGGCCAGG + Intronic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957399914 3:79697148-79697170 TTGGGAAGGCAGATGGAACAGGG + Intronic
957407933 3:79795955-79795977 TTTCAATGGCAGAAGAAAACAGG + Intergenic
957853953 3:85849101-85849123 AGAGAATGGCAGAAGGAACCTGG + Intronic
958601151 3:96298592-96298614 TTTGACAGGCATTAGGACCCAGG - Intergenic
959148336 3:102576568-102576590 TTTATAAGGCAGAAGGAAAAAGG + Intergenic
959187260 3:103060327-103060349 TTTCAAAGGGAGAAAGAAGCAGG + Intergenic
959615308 3:108340840-108340862 TTTGAAAGAAAGAAAGAAACAGG + Intronic
960165896 3:114400852-114400874 ATTGAAAGGCAGAGGGTATCAGG + Intronic
960379440 3:116941061-116941083 TTTATAAGCCAGAAGGAACTGGG + Intronic
960769716 3:121180251-121180273 TTTACAAGCCAGAAGGAACTGGG + Intronic
962345515 3:134616172-134616194 ATAGAAAGTCAGAAGGAAACTGG + Intronic
962629142 3:137258393-137258415 TTTGAAGGGAAGATGGAAGCAGG + Intergenic
963205313 3:142628177-142628199 TTTGAAAGGAACATGGAACTGGG + Intronic
964421392 3:156507388-156507410 TCTGTAAGGCAAATGGAACCAGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
966025438 3:175274534-175274556 TCTGAAAGGAAGAAGCAAACTGG - Intronic
966149256 3:176848709-176848731 TCTCAAGGGCAGAAGGAACAAGG + Intergenic
966699509 3:182831551-182831573 TAGGAAATGAAGAAGGAACCAGG - Intronic
967136899 3:186520070-186520092 TTTGAAAGAGACAAGCAACCAGG - Intergenic
967340493 3:188391929-188391951 TTTGAAAGGCAAAAGTAAGATGG - Intronic
968017785 3:195354755-195354777 TTTTAAAGGCAGTAGTATCCAGG - Intronic
968261111 3:197324817-197324839 ATTGGAAGGCAGAAGGGGCCAGG + Intergenic
968839926 4:2995780-2995802 TTTTAAAGGCAAAGGGAACAAGG + Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
970069735 4:12144125-12144147 TTTTGAAGGCAGAGGGAAACTGG - Intergenic
970132421 4:12885987-12886009 TTGGAAAGGCAGAAGGTACTTGG + Intergenic
970252604 4:14131749-14131771 TTTTTGAGCCAGAAGGAACCTGG - Intergenic
970274459 4:14383131-14383153 TTTGGAAGGCAGAAGTAAGTTGG + Intergenic
970755950 4:19427374-19427396 TGTGAAAGGCAGAAGGAAGTAGG - Intergenic
972082498 4:35171414-35171436 TTTAAATGGCAGAAGGGACTTGG + Intergenic
973178568 4:47240226-47240248 TTTGAGAGGAAGAAGGAGCAAGG + Intronic
973635477 4:52858324-52858346 TTTGAAAGGCAGAAGCAAGGAGG + Intergenic
974012804 4:56623072-56623094 CTAGAAAGGCAGCAGGAAGCTGG - Intergenic
974526322 4:63053823-63053845 TCTGACAGGCAGTAGGACCCAGG - Intergenic
974972001 4:68842335-68842357 TTTGACAGGCATTAGGACCCAGG + Intergenic
975130499 4:70827851-70827873 TTTGAAAGTGAGAAGGAAATAGG - Exonic
975415241 4:74098262-74098284 TCTGAAAGTCAGTAGGAACTAGG + Intronic
975440436 4:74404302-74404324 TTTGGGAGCTAGAAGGAACCTGG - Intergenic
975499124 4:75065742-75065764 TTTGAAAGTCAGAAGGAAGTAGG - Intergenic
975608705 4:76182443-76182465 TTTAAAAAGTAGAAGGAAGCAGG - Intronic
976720894 4:88167670-88167692 TTTAAAAGGCAGAAAGAGCCTGG - Intronic
977335280 4:95689964-95689986 TTTGAAAGGTAGAAAGAAGGAGG - Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978066056 4:104404304-104404326 ATTGAAAGGCAGAAAGAATCAGG - Intergenic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
978979083 4:114919428-114919450 CATGAAAGGCAGAAGAAATCAGG + Intronic
980353566 4:131715227-131715249 TTTGAAAGGCAAGATGAATCTGG - Intergenic
981107904 4:140902209-140902231 TTTAAAAGGCAGAATGAACAGGG + Intronic
981872288 4:149501139-149501161 TTGGAAATGCAGAAGCAATCAGG - Intergenic
982155580 4:152517116-152517138 TTAGAAAGGCAGAAACAGCCTGG - Intronic
982361483 4:154523960-154523982 TTAAAAAGGCAGAGGGGACCGGG - Intergenic
982881384 4:160722115-160722137 TTTGAAAAGGAGAATGAACATGG - Intergenic
982885337 4:160773069-160773091 TTTGAAAGAGAGAAGAAACTGGG + Intergenic
983550248 4:169010140-169010162 TTTAAAAGCCTGAGGGAACCTGG - Exonic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
984341087 4:178456944-178456966 TTTGAATGAGAGAAAGAACCGGG + Intergenic
986425924 5:7631460-7631482 CTTGAAAGACAGAAGGGCCCTGG - Intronic
986449734 5:7852065-7852087 TTTGAATGGCAGCAGGAAGTGGG + Intronic
986875314 5:12100318-12100340 TTCCAAAGCAAGAAGGAACCAGG + Intergenic
986990994 5:13552961-13552983 TTGGAGAGGTAGAAAGAACCTGG + Intergenic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
987373478 5:17214252-17214274 TTTGAAAAGCTGAAGGCACATGG + Intronic
987500600 5:18704369-18704391 TTTGAAAGGCAGTAGAAGCCGGG - Intergenic
990996725 5:61739559-61739581 TTTGAAACACGGAAGGAACAGGG + Intronic
991944594 5:71887750-71887772 TCAGCAAGACAGAAGGAACCTGG - Intergenic
992363208 5:76063928-76063950 TTAGAAAGGCAGATGTACCCTGG + Intergenic
993315661 5:86402967-86402989 TTTGAAAAGAAAGAGGAACCTGG - Intergenic
993502936 5:88682302-88682324 TTTGAAATGCAGTGGGAAACAGG - Intergenic
998074875 5:139227584-139227606 TTTGGAAGGCTGAATGAAGCAGG + Intronic
998586017 5:143428482-143428504 TTGGAAAGGCAGAAGGAGTCAGG - Intronic
998914816 5:147002048-147002070 TTTGACAGGCATTAGGACCCAGG - Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001285479 5:170420082-170420104 ATTGAAAAGAAAAAGGAACCAGG + Intronic
1001689956 5:173625587-173625609 TCTGACAGGCAGCAGGAGCCAGG - Intergenic
1002854840 6:1027450-1027472 GCTGAAAGGCCGAAGGAACAAGG + Intergenic
1002917833 6:1543051-1543073 TCGGAAAGGCAGAAGGGGCCTGG + Intergenic
1002954488 6:1848414-1848436 CTTTAAAGGCAGTAGGAGCCAGG - Intronic
1003561202 6:7182061-7182083 TCGGATTGGCAGAAGGAACCAGG + Exonic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1004767888 6:18751811-18751833 TTTTAAAGCTAGAAGGAACCAGG + Intergenic
1004986748 6:21091422-21091444 TTTGAAAGGGAGAATGAAGTAGG + Intronic
1005340488 6:24839273-24839295 CTGTAAAGGCAGAAGGCACCAGG + Intronic
1007095388 6:39209641-39209663 TGCGAGAGGCAGAAGGAACGAGG + Intronic
1007136033 6:39522754-39522776 TGTGAAAGGCAGAAGAGAGCTGG - Intronic
1007850241 6:44795643-44795665 TTTGCATGGCAAAAGGAACCTGG - Intergenic
1007893423 6:45319328-45319350 TTTGTAAGGCAGGAGGAAGCAGG + Intronic
1009475269 6:64083437-64083459 CTTGAGGGGCAGAAGTAACCTGG + Intronic
1010097888 6:72068215-72068237 TTTGTGAGGCAGATGGAACATGG - Intronic
1012282784 6:97348865-97348887 TTTGAAGTGCAGGACGAACCTGG + Intergenic
1012550731 6:100463247-100463269 TTTCAAAGGCAGAAGGGGCCGGG - Intronic
1013968425 6:115984713-115984735 TGTGAATGGCAGAGGGAAACAGG - Intronic
1014269393 6:119319868-119319890 TTTTCAAGGCAGAAGGAAGAGGG - Intronic
1014926370 6:127276004-127276026 TTTAAAAGGCAAAATGGACCAGG - Intronic
1015486039 6:133771069-133771091 TTTCAAAGGAAGAAAGAACAAGG + Intergenic
1016252880 6:142067941-142067963 TTTGCAAAGCAGAAAGAGCCTGG - Intronic
1016271919 6:142300383-142300405 TTTTAAAGTTAGAAGAAACCTGG - Intergenic
1016683748 6:146858208-146858230 TTTGACAGGTAGAATGAATCTGG - Intergenic
1016869882 6:148806632-148806654 TTTGAAAGGCATAGGGGGCCGGG - Intronic
1017213128 6:151879161-151879183 CCTGAGAGGCAGAAGGAACTGGG + Intronic
1018730321 6:166645454-166645476 TGTGACTGGCAGAAGGAACAGGG - Intronic
1019285940 7:223135-223157 TATGAAGGGCAGATGGGACCAGG + Intronic
1019429143 7:990773-990795 CTTGAAGGGCAGAAAGAACGGGG + Intergenic
1019754696 7:2760464-2760486 TTTGACAGGCAGAAGGGCCTGGG - Intronic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021654453 7:22861601-22861623 TTTGAAGGGCAGAAGGTGCAGGG + Intergenic
1022470359 7:30678223-30678245 TTTGAAAGGCAGCAGAACCTGGG + Intronic
1022834264 7:34098658-34098680 TTTGAACTGCTGAAAGAACCTGG + Intronic
1023379164 7:39588741-39588763 TTTAAAACTCAGAAGGAAGCAGG - Intronic
1023530217 7:41145689-41145711 TTTGAGATGCAGAATGAAACTGG - Intergenic
1023610711 7:41967719-41967741 TTTGCAAGCCAGGAGAAACCCGG - Exonic
1026305717 7:69139448-69139470 TTTGAAAGGCAAAAAAAATCTGG + Intergenic
1026661200 7:72304273-72304295 TTTGAAAGACAGGAAGAACGTGG - Intronic
1026739964 7:72972955-72972977 TTTGAGAGGCGGAAGGCACAAGG - Intergenic
1026797230 7:73374108-73374130 TTTGAAAGGCAGAAGGCACAAGG - Intergenic
1027103769 7:75392115-75392137 TTTGAGAGGCGGAAGGCACAAGG + Intergenic
1027370650 7:77506160-77506182 TAGGAAGGGCTGAAGGAACCAGG + Intergenic
1027815538 7:82965529-82965551 TTTGATAGGCATAAGAAACAGGG + Intronic
1030000365 7:105053186-105053208 TTTTAAAGGCATTAGGAAACTGG + Intronic
1030089360 7:105843681-105843703 ATTGAAAAGAAGAGGGAACCTGG - Intronic
1030343060 7:108402529-108402551 TTTGGGAGACAGAAGGAGCCTGG + Intronic
1031066984 7:117115665-117115687 TTTTAAAGGCAGAATGGACTTGG + Intronic
1031437820 7:121754050-121754072 TCTGAAAGGACAAAGGAACCAGG - Intergenic
1032950709 7:136907907-136907929 TTGGAAAGGCAGAATGATACTGG - Intronic
1033445281 7:141416054-141416076 TCTGAGAGCCAGAAGGAGCCAGG + Intronic
1033784469 7:144714115-144714137 GTTGAAAGGAAGAAGGACCATGG - Intronic
1034068751 7:148162138-148162160 TTTAAAAGACAGATGGAAGCAGG + Intronic
1034440817 7:151085313-151085335 TTTGGAAGGTACAAGGAACTCGG + Intergenic
1034623836 7:152477340-152477362 TTTGAGAGGCTGAATGAAGCAGG - Intergenic
1034927921 7:155138190-155138212 TTTGAAGGGCAGAGGCAAGCAGG + Intergenic
1036211207 8:6842692-6842714 TACGTAAGGCAGAAGGAACCTGG + Intergenic
1037090783 8:14915484-14915506 GGTGAATGCCAGAAGGAACCAGG + Intronic
1038005051 8:23422933-23422955 TTAAAAAGGTAGAAGGAAACAGG + Intronic
1038945105 8:32350473-32350495 TTTGAAAGTCAGATGGACCTTGG + Intronic
1039344353 8:36687608-36687630 TTTGAAAGGTAAAAGGAAGCAGG + Intergenic
1039429944 8:37517853-37517875 ATTGAAAGGCAGCAGGGAGCTGG - Intergenic
1039432454 8:37535574-37535596 TCTTGAAGGAAGAAGGAACCAGG - Intergenic
1039457305 8:37716014-37716036 ATTGAAGGGGAGAAGGAGCCAGG + Intergenic
1039468467 8:37799507-37799529 TATCAAAGGCAGAAGGAAGTGGG + Intronic
1039968105 8:42298591-42298613 TTTGGAAAGCATAAGTAACCAGG + Intronic
1041530814 8:58864839-58864861 ATTGAAAGGGAAAAGGAACTTGG + Intronic
1041592494 8:59605079-59605101 TTCTAAAGTCAGAAGGGACCAGG - Intergenic
1041747643 8:61225875-61225897 CATGAAAGGCAGATGCAACCTGG - Intronic
1042029604 8:64461681-64461703 TTAAAAAGACAGAAGAAACCTGG - Intergenic
1043101259 8:76049448-76049470 TTGAATAGGCAGCAGGAACCAGG + Intergenic
1044311886 8:90703070-90703092 TAAGAAAGGCAGCAGGATCCAGG - Intronic
1044469612 8:92551111-92551133 TTTGAAAGGTAGAATAAGCCAGG - Intergenic
1044822169 8:96161716-96161738 ATTGGAATGCAGAAGGAACTTGG - Intergenic
1044899844 8:96932645-96932667 TTTGAAAGACAGGAGGACCAAGG - Intronic
1045097382 8:98812125-98812147 TTTAAAAGGCAAAAGGGAGCAGG - Intronic
1046035538 8:108836529-108836551 TTTGAAAGGCAAGATTAACCTGG - Intergenic
1046236977 8:111436937-111436959 ATTGAAAGGTGAAAGGAACCTGG + Intergenic
1047360857 8:124167846-124167868 CTTGAATGACAGAAGAAACCTGG - Intergenic
1047463949 8:125094140-125094162 TATGAAGGGGAGAAGGAAACAGG + Intronic
1048384372 8:133897918-133897940 TTTGATAGAAAGCAGGAACCAGG - Intergenic
1048421281 8:134280657-134280679 TTTAAAAAGCAGAAGGCAGCTGG + Intergenic
1048462242 8:134630729-134630751 TTTGAATGGTAGCAGAAACCAGG - Intronic
1049010891 8:139886687-139886709 TATGAAAGGAAGAAGGAAGGTGG - Intronic
1051319837 9:15890654-15890676 GTTGAAAATCAGAAGGCACCTGG + Intronic
1052027607 9:23591075-23591097 TTTGATAGGCATAAGGAAGGAGG + Intergenic
1052492468 9:29187816-29187838 TTGGAAAGCCAGAAGGAAACTGG + Intergenic
1053155885 9:35778938-35778960 TTTGAGTGACAGAAGGAACCAGG - Intergenic
1053458142 9:38247092-38247114 TTTGGAAGGAAGAAGGAAAAGGG - Intergenic
1053626881 9:39881842-39881864 TTTGAAAGGCAAGATGAATCTGG - Intergenic
1053779108 9:41584178-41584200 TTTGAAAGGCAAGATGAATCTGG + Intergenic
1054167067 9:61794419-61794441 TTTGAAAGGCAAGATGAATCTGG + Intergenic
1054217005 9:62368861-62368883 TTTGAAAGGCAAGATGAATCTGG + Intergenic
1054670479 9:67786479-67786501 TTTGAAAGGCAAGATGAATCTGG - Intergenic
1055995582 9:82155566-82155588 TTTGAAAGGCAGAATAAATGTGG + Intergenic
1056300267 9:85232974-85232996 TTTGAAAAGCAGAAGAAATATGG - Intergenic
1056511454 9:87309949-87309971 TTCGAATGGCAGGAGGCACCAGG - Intergenic
1057120396 9:92566976-92566998 TTTGGAAGGCAGAAGGCACTGGG + Intronic
1057227996 9:93302557-93302579 TTTGAAATATAGAAGGATCCTGG + Intronic
1058682429 9:107451878-107451900 TCTGAAAGGCAGGTGGAACCAGG - Intergenic
1059774036 9:117457018-117457040 TTTGAAAAGCAGAAGGGCCAAGG + Intergenic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1185826462 X:3255903-3255925 TTTCAAAGGCGAAAGGAAACAGG - Intergenic
1186898774 X:14031579-14031601 TGGGAAAGGCAGAAGGATGCAGG + Intergenic
1187042668 X:15613353-15613375 CTGGAAAGGTAGAAGGACCCGGG + Intergenic
1188309290 X:28597418-28597440 TTTGAAAGGAAGAAAGAAAGAGG - Intronic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1188731869 X:33657894-33657916 TTTGAAAGACAGACAGAAACCGG + Intergenic
1188755333 X:33954476-33954498 TGTGAAAAGCAGAAGGCACTAGG - Intergenic
1189145578 X:38651589-38651611 TTTGAAAGGCAGGTAGGACCTGG + Intronic
1189707183 X:43770354-43770376 TGTGGAAGGGAGAAGGAAGCAGG - Intronic
1192319562 X:70078597-70078619 TTTGAAAGGAGGAAGGAAATGGG + Intergenic
1193329088 X:80215708-80215730 TTTCCTAGGCAGAAGGACCCTGG - Intergenic
1194223164 X:91222581-91222603 TTAGAAAGGAAGAAGGAAGGAGG + Intergenic
1194238567 X:91414996-91415018 TTTGGAAGGCAGAAGGGAGACGG - Intergenic
1194468636 X:94264546-94264568 TATAAAAGACAGAAGGAACTGGG + Intergenic
1194607609 X:96000705-96000727 CTTCAGAGGCAAAAGGAACCTGG - Intergenic
1194714406 X:97274168-97274190 TTTGAAAACCAGAAGGACTCTGG + Intronic
1195672661 X:107482890-107482912 GTTGATGGGCAGAAGGAACAGGG + Intergenic
1196145725 X:112314877-112314899 TAAGAAAGGCAGAAGAAAACAGG - Intergenic
1196628485 X:117907069-117907091 TTTGAAAGGGAAAAGAAACAAGG - Intronic
1197513134 X:127395921-127395943 TCTGAAAGGCATTAGGACCCAGG - Intergenic
1198244815 X:134820041-134820063 GTGGAAAGATAGAAGGAACCTGG - Intronic
1198510328 X:137343993-137344015 TTGGAAAGGCAGAATTCACCAGG - Intergenic
1198621897 X:138521744-138521766 TGTGAAAGGCAGTAGGAAACCGG - Intergenic
1200789921 Y:7290634-7290656 TTTGAAAGGCAGAACGGATGGGG - Intergenic
1201360705 Y:13145313-13145335 TTTGCAAGCCAGAAAGAAGCAGG + Intergenic
1201568820 Y:15392847-15392869 TCTGAAAGGCATTAGGATCCAGG + Intergenic