ID: 1061532669

View in Genome Browser
Species Human (GRCh38)
Location 9:131227310-131227332
Sequence AGCCCACTGGGCAGCAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061532661_1061532669 9 Left 1061532661 9:131227278-131227300 CCACCTGTGTGGTGCTGCCCTCT 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG No data
1061532657_1061532669 29 Left 1061532657 9:131227258-131227280 CCTGACCCTTGTCTGTGTGGCCA 0: 1
1: 0
2: 2
3: 16
4: 221
Right 1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG No data
1061532665_1061532669 -9 Left 1061532665 9:131227296-131227318 CCTCTGGCAGCCTGAGCCCACTG 0: 1
1: 1
2: 0
3: 41
4: 379
Right 1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG No data
1061532658_1061532669 24 Left 1061532658 9:131227263-131227285 CCCTTGTCTGTGTGGCCACCTGT 0: 1
1: 0
2: 0
3: 23
4: 289
Right 1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG No data
1061532664_1061532669 -8 Left 1061532664 9:131227295-131227317 CCCTCTGGCAGCCTGAGCCCACT 0: 1
1: 0
2: 4
3: 24
4: 244
Right 1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG No data
1061532659_1061532669 23 Left 1061532659 9:131227264-131227286 CCTTGTCTGTGTGGCCACCTGTG 0: 1
1: 0
2: 0
3: 45
4: 320
Right 1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG No data
1061532663_1061532669 6 Left 1061532663 9:131227281-131227303 CCTGTGTGGTGCTGCCCTCTGGC 0: 1
1: 0
2: 4
3: 21
4: 236
Right 1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061532669 Original CRISPR AGCCCACTGGGCAGCAGTGT TGG Intronic
No off target data available for this crispr