ID: 1061536135

View in Genome Browser
Species Human (GRCh38)
Location 9:131251512-131251534
Sequence CAGCAAGATGGCCTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061536128_1061536135 7 Left 1061536128 9:131251482-131251504 CCACGGCGCTGCACAGCCTCAAA No data
Right 1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG No data
1061536127_1061536135 11 Left 1061536127 9:131251478-131251500 CCGGCCACGGCGCTGCACAGCCT No data
Right 1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG No data
1061536124_1061536135 24 Left 1061536124 9:131251465-131251487 CCCGGGACAGATGCCGGCCACGG No data
Right 1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG No data
1061536129_1061536135 -9 Left 1061536129 9:131251498-131251520 CCTCAAAGCATGTCCAGCAAGAT No data
Right 1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG No data
1061536126_1061536135 23 Left 1061536126 9:131251466-131251488 CCGGGACAGATGCCGGCCACGGC No data
Right 1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061536135 Original CRISPR CAGCAAGATGGCCTGTGGGG TGG Intergenic
No off target data available for this crispr