ID: 1061537251

View in Genome Browser
Species Human (GRCh38)
Location 9:131257835-131257857
Sequence GGTGCAAGGCTGAGACCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061537237_1061537251 18 Left 1061537237 9:131257794-131257816 CCCACCACCCTCCAGGCAGGGCA No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data
1061537242_1061537251 10 Left 1061537242 9:131257802-131257824 CCTCCAGGCAGGGCACTGGCAGG No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data
1061537246_1061537251 7 Left 1061537246 9:131257805-131257827 CCAGGCAGGGCACTGGCAGGGGC No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data
1061537238_1061537251 17 Left 1061537238 9:131257795-131257817 CCACCACCCTCCAGGCAGGGCAC No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data
1061537241_1061537251 11 Left 1061537241 9:131257801-131257823 CCCTCCAGGCAGGGCACTGGCAG No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data
1061537232_1061537251 26 Left 1061537232 9:131257786-131257808 CCTCCAAGCCCACCACCCTCCAG No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data
1061537234_1061537251 23 Left 1061537234 9:131257789-131257811 CCAAGCCCACCACCCTCCAGGCA No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data
1061537239_1061537251 14 Left 1061537239 9:131257798-131257820 CCACCCTCCAGGCAGGGCACTGG No data
Right 1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061537251 Original CRISPR GGTGCAAGGCTGAGACCGCA GGG Intergenic
No off target data available for this crispr