ID: 1061537365

View in Genome Browser
Species Human (GRCh38)
Location 9:131258434-131258456
Sequence AAGGGCAGAAAGAAGGGGCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1151
Summary {0: 1, 1: 1, 2: 11, 3: 101, 4: 1037}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061537354_1061537365 8 Left 1061537354 9:131258403-131258425 CCAGGGTGTTCCTAGCCCTTCTT 0: 1
1: 0
2: 3
3: 14
4: 242
Right 1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG 0: 1
1: 1
2: 11
3: 101
4: 1037
1061537352_1061537365 20 Left 1061537352 9:131258391-131258413 CCTGCAGCCTCTCCAGGGTGTTC 0: 1
1: 0
2: 4
3: 25
4: 292
Right 1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG 0: 1
1: 1
2: 11
3: 101
4: 1037
1061537360_1061537365 -7 Left 1061537360 9:131258418-131258440 CCCTTCTTCGGTGAGGAAGGGCA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG 0: 1
1: 1
2: 11
3: 101
4: 1037
1061537350_1061537365 25 Left 1061537350 9:131258386-131258408 CCGGACCTGCAGCCTCTCCAGGG 0: 1
1: 1
2: 3
3: 49
4: 488
Right 1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG 0: 1
1: 1
2: 11
3: 101
4: 1037
1061537361_1061537365 -8 Left 1061537361 9:131258419-131258441 CCTTCTTCGGTGAGGAAGGGCAG 0: 1
1: 0
2: 1
3: 18
4: 138
Right 1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG 0: 1
1: 1
2: 11
3: 101
4: 1037
1061537353_1061537365 13 Left 1061537353 9:131258398-131258420 CCTCTCCAGGGTGTTCCTAGCCC 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG 0: 1
1: 1
2: 11
3: 101
4: 1037
1061537357_1061537365 -2 Left 1061537357 9:131258413-131258435 CCTAGCCCTTCTTCGGTGAGGAA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG 0: 1
1: 1
2: 11
3: 101
4: 1037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061537365 Original CRISPR AAGGGCAGAAAGAAGGGGCA CGG Exonic
900869094 1:5289169-5289191 AAGGTCAGAAAGAAGAGCCCAGG - Intergenic
902195799 1:14797028-14797050 AAGGGCAGAAAGGTGGTGCTGGG + Intronic
902293328 1:15449270-15449292 CAAGGCAGGAAGAAGGGGAAGGG - Intergenic
902407712 1:16194759-16194781 AAAGGGAGAAAGAAAGGGAAAGG + Intergenic
902464586 1:16608139-16608161 AAGAGCAGAAAGCAGGTGAAAGG + Intronic
902550837 1:17218761-17218783 AAGGGAGGGGAGAAGGGGCAAGG + Intronic
902699825 1:18164275-18164297 AAGGGGAGAGGGAAGGAGCAAGG - Intronic
903156222 1:21445566-21445588 AAGAGCAGAAAGCAGGTGAAAGG - Intronic
903282385 1:22257398-22257420 AGGGGGAGGAGGAAGGGGCAGGG - Intergenic
903604185 1:24562914-24562936 AAGGGCATAAGGAGGGGGAAGGG - Intronic
903642131 1:24867430-24867452 TAGGGCAGGGAGAATGGGCAAGG + Intergenic
904071345 1:27800226-27800248 ATAAGCAGAAAGAAGGGGTAAGG - Intronic
904322803 1:29707855-29707877 AGGTGCAGAAAGATGGGGCTGGG - Intergenic
904785966 1:32983261-32983283 AAGGGCAGAGAGAAGGGCAAGGG + Intergenic
905051048 1:35051499-35051521 AAGGGCAAGAAGAATGGGAAAGG - Intergenic
905076901 1:35280188-35280210 AAGGGAAGAAAGGAAGGGAAGGG - Intronic
905167227 1:36089768-36089790 AAGAGCAGAAAGCAAGGCCAAGG - Intronic
905508984 1:38503452-38503474 GAGGGAAGGAAGAAGGAGCATGG - Intergenic
905591730 1:39169750-39169772 AAAGAAAGAAAGAAAGGGCAAGG - Intronic
906428087 1:45731138-45731160 CAGGCTAGAAAGAAGTGGCAAGG + Intronic
906513517 1:46424670-46424692 AAGGGCGGGAAGGAGGGACATGG + Intergenic
906711546 1:47934022-47934044 GAGGGTAGAAAGAAGGGGTTGGG + Intronic
907393733 1:54175442-54175464 AAGGGCAGAGAGAAGGATCCTGG - Intronic
907494663 1:54835942-54835964 AAGGGCAGGAAGATGGGTCATGG - Intronic
907604358 1:55802158-55802180 AAGGGCAAACGGAAGGGTCAAGG - Intergenic
907809250 1:57852076-57852098 CAGGGGAGAAAGAAGAGGAAGGG - Intronic
907983723 1:59509624-59509646 AAGGACAGAAAAAAGGGAGAAGG - Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908784734 1:67723719-67723741 AAGGTCAGAAAGAAGGTTAATGG + Intronic
909774918 1:79471838-79471860 AAGGTCAAGATGAAGGGGCAAGG + Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
909918090 1:81345731-81345753 AAGGCAAGAAAGAAGTGGAAAGG + Intronic
909931487 1:81503844-81503866 CATGGCAGAAGGCAGGGGCAGGG - Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911668859 1:100586000-100586022 AAAGGCAGAAACAAGGAGCATGG - Intergenic
911960480 1:104296008-104296030 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
912412899 1:109490246-109490268 AAAGGCAGAAGGAAGGTGCATGG - Intronic
912464649 1:109863319-109863341 AAAGGCAGAAAGTGGGGACAGGG + Intergenic
912470148 1:109901207-109901229 AAGGACAGAAGGGAGGGGCAGGG - Intergenic
912523833 1:110266145-110266167 AGGGGGAGAAATAATGGGCAGGG + Intronic
912553927 1:110502484-110502506 AAAGGCAGAAATAAGGTGAAGGG + Intergenic
912559134 1:110537697-110537719 AGGCTGAGAAAGAAGGGGCAGGG + Intergenic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912876385 1:113364218-113364240 AAGGGGAGAAAGATGGAACAAGG + Intergenic
913082960 1:115406691-115406713 AAGTGTAAAATGAAGGGGCAAGG - Intergenic
913461213 1:119087850-119087872 AAGAGCAGAAAGAAGGTGAGAGG + Intronic
914774212 1:150721022-150721044 AAAGCCAGACAGAAGGGGGAAGG + Intergenic
914829410 1:151159684-151159706 GAGTGCAGGAAGAAGGGGCTAGG + Exonic
915001444 1:152597576-152597598 AAGGCCAGAAAACAGGGGCATGG - Intronic
915410574 1:155698614-155698636 AAGAGCACAAAGAAAGGGAAAGG - Intronic
915475025 1:156148156-156148178 AAGGGAAGAAAATAGGGGCAGGG + Intronic
915594203 1:156887253-156887275 GAGGGAAGAAAGAAGGGAGAGGG - Intergenic
915943284 1:160132483-160132505 TAGGGCAGAAACAAAGGGAATGG + Intronic
916168696 1:161984904-161984926 ATGGGCGGAATGAAGGGGCCTGG - Exonic
916293281 1:163189326-163189348 AAGGGCAGAAGGAAGAGTCAAGG + Intronic
916650822 1:166832745-166832767 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
916701972 1:167305858-167305880 AAGGGCAGGAGGGTGGGGCAGGG + Intronic
917310016 1:173669298-173669320 AAGAGCATAAACAAAGGGCAAGG + Intronic
917429857 1:174954786-174954808 AGGAGCAGAAACAAGGGCCAAGG - Intronic
917535709 1:175872947-175872969 AAAGGGAGAGAGAAGGGACAAGG + Intergenic
917789350 1:178489475-178489497 AAGGAGAGAAGGAAAGGGCAAGG + Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918077340 1:181180685-181180707 CAGGGCAGAAACAATGGGGAAGG - Intergenic
918116795 1:181504675-181504697 AAGCACAGAAAGCTGGGGCAAGG - Intronic
918144267 1:181742036-181742058 AAGGGGAGAGGGAATGGGCATGG - Intronic
918234810 1:182570340-182570362 AAGGGAAGACAGAGGGGTCAGGG - Intergenic
918974723 1:191468216-191468238 AAGGGCAGAATCAAGGGAGAAGG + Intergenic
919224378 1:194675968-194675990 AAGGGCGGATAGAAGGTGTAAGG - Intergenic
919613151 1:199772025-199772047 AAGGGGAAAAGGAAGGGGAAAGG + Intergenic
919816621 1:201444892-201444914 AAGGGGAGAAAGCAGAGGCATGG + Intergenic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
920125855 1:203693234-203693256 TAGGGCAGAAAGAATTGGAATGG + Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
921257663 1:213357016-213357038 AGGGGCAGAAAGCAGGGGCCAGG + Intergenic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
921723092 1:218495236-218495258 AAGGGAAGAAAGAAGAAGCCCGG - Intergenic
921992050 1:221377500-221377522 AGTGGAAGAAAGAAGGGACATGG - Intergenic
922036991 1:221858490-221858512 AAGGAAAGAAAGAAGGGGCTGGG + Intergenic
922718974 1:227890705-227890727 CAGGGCAGAAAGAAGAGGGTGGG + Intergenic
922719230 1:227891869-227891891 TGGGGCAGAAAGCAGGTGCAGGG - Intergenic
922979346 1:229812426-229812448 AAGGAAAGAAAGAAAGGGAAGGG + Intergenic
923023528 1:230186249-230186271 GAGGGCACAAAGGAGGGGCTTGG - Intronic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923356146 1:233157699-233157721 AAGTCCAGGAAGAAGAGGCAAGG + Intronic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
924464213 1:244285466-244285488 AATGGCAGAAAGAAGCCCCAAGG - Intergenic
1063031030 10:2234604-2234626 AAGGGCAGAAAGAGGGGCTGGGG + Intergenic
1063498368 10:6530612-6530634 AAGTGCAGAAAGAAAGAGCTGGG + Intronic
1063656010 10:7989306-7989328 GAGGGCTGAAGGCAGGGGCAAGG + Intronic
1063977468 10:11428897-11428919 AAAGGCAGAAAGAAGGGAGGTGG - Intergenic
1064068798 10:12207438-12207460 AAGGAGAGAAAAAAGGGACATGG - Intronic
1064283751 10:13973744-13973766 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1064715670 10:18174225-18174247 GAGGGGAGAAGGAAGGGGAAGGG - Intronic
1064732959 10:18351333-18351355 AAGGCAAGAAAGAAGGTGCTTGG + Intronic
1064863488 10:19853126-19853148 AAAGGCTGAAGGAAGGGACAAGG + Intronic
1064921151 10:20519932-20519954 AAGGGTAGAAAGGAGGGGAAGGG - Intergenic
1064994588 10:21285436-21285458 AAAGGCAGGAAGATGGGGAAGGG - Intergenic
1065516908 10:26532850-26532872 AAGGACAGAAAGAAGCAGAAAGG - Intronic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066413163 10:35193345-35193367 AAGGAAAGAAAGAAGGGAAATGG - Intronic
1066532991 10:36360874-36360896 GAGGGCAGCAGGAAGGGCCAGGG + Intergenic
1066671469 10:37844948-37844970 AAGGGAAGAAGGAAGGGGGGAGG - Intronic
1066961221 10:42230208-42230230 AAGGGGACAGGGAAGGGGCAAGG + Intergenic
1066995578 10:42559988-42560010 AAAGGAAGAATGAAGGGGAATGG + Intergenic
1068058524 10:52038381-52038403 AAGCACAGAAATAAGGGGTAGGG + Intronic
1068282016 10:54885250-54885272 AAGGGCTTCAAGAAGGGGGAAGG + Intronic
1068665985 10:59676571-59676593 AAGGGGGGGAAAAAGGGGCAAGG + Intronic
1068842636 10:61632328-61632350 AAGGTAAGAAAGGAAGGGCAGGG - Intergenic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069635015 10:69919774-69919796 AAGGCCAGAGAGTAGGGGAATGG - Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069757907 10:70785132-70785154 AGGGACAGAGAGCAGGGGCAGGG - Intronic
1069896550 10:71683693-71683715 AAGGGCAGAGAGTTGGGGCCTGG + Intronic
1070068118 10:73058154-73058176 AAGGGAAAAAAGAAAGGGGATGG + Intronic
1070220334 10:74436137-74436159 AACAGCAGAAAGGAGGTGCATGG + Intronic
1070711542 10:78686715-78686737 AAGGGCAGGAACCGGGGGCAGGG + Intergenic
1070741680 10:78907522-78907544 AAGGCCAGAGAGTTGGGGCAGGG - Intergenic
1070753995 10:78980435-78980457 GACGGCATCAAGAAGGGGCAAGG + Intergenic
1072565801 10:96615729-96615751 CAGGTGAGAAAGAAGAGGCATGG + Intronic
1072645458 10:97251093-97251115 AAGGGGAAAAGGAAGGGGAAGGG + Intronic
1072899701 10:99396090-99396112 AAGGAAGGAAAGGAGGGGCAGGG + Intergenic
1072990201 10:100185758-100185780 AAGGGAAGAATGAGGGGACAGGG - Exonic
1073062900 10:100742824-100742846 AAAGGAAGAAAGAAGAGGAAAGG - Intronic
1073713933 10:106080229-106080251 AAAGGCAGAAAGAAGGCAAAAGG + Intergenic
1073761330 10:106631797-106631819 AAGACCAGACAGAAAGGGCAAGG - Intronic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1074420920 10:113308228-113308250 AAGGGCAAAATGAAAGGGCCAGG - Intergenic
1074452222 10:113568453-113568475 ATGGGCAGAAAGATGAGGCCAGG + Intronic
1074484311 10:113858212-113858234 AAGGGAAGAAAGAAAAGGAAGGG - Intronic
1074596792 10:114875361-114875383 AAGTGAAGAAAGAAGAAGCAAGG + Intronic
1074598482 10:114889407-114889429 AAGGCAAGAATGAAGGAGCAGGG - Intronic
1075065669 10:119287397-119287419 AAGGGAGGAAAGAAGGGAGAAGG + Intronic
1075245420 10:120818077-120818099 AAGGAAAGAAAGAAGGGGCCAGG - Intergenic
1075284477 10:121171767-121171789 AGGGGAAGGAAGAAGGGGAAGGG + Intergenic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075284490 10:121171803-121171825 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284497 10:121171821-121171843 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284504 10:121171839-121171861 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075303677 10:121348512-121348534 AGGGGAAGAAAGGTGGGGCAAGG - Intergenic
1075420277 10:122295305-122295327 AGGGGGAGAAAGAGGGGACAGGG + Intronic
1075617585 10:123902926-123902948 AAGGGAAGAATGAAAGGGCACGG - Intronic
1075627609 10:123973797-123973819 AAAGCCAGAAAGAAGGGACCAGG - Intergenic
1076076664 10:127538837-127538859 AAGGGCCGTAAGCAGGGGCGGGG - Intergenic
1076368897 10:129939241-129939263 GAGGGCAGGAAGGAGGGCCAGGG - Intronic
1076453722 10:130575078-130575100 GAGGGAAGAAAGGAGGGGAAGGG - Intergenic
1076790545 10:132774853-132774875 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790576 10:132774940-132774962 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790597 10:132775000-132775022 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076790603 10:132775013-132775035 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790646 10:132775113-132775135 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790662 10:132775160-132775182 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1077606814 11:3617852-3617874 GAAGGCAGAAAGAGGGGACAAGG + Intergenic
1077745656 11:4901453-4901475 AAGAGCACAAAGAGGGGGCCGGG - Intronic
1078149503 11:8746700-8746722 TAGGGCAGAAAGAAAGACCAGGG + Intronic
1078391444 11:10938665-10938687 AAGAGGAAAAAGAAGGGGAAGGG - Intergenic
1078807953 11:14725504-14725526 AAGGGGAGAAGGAGGGGGAAGGG - Intronic
1079104182 11:17559816-17559838 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1079119588 11:17672346-17672368 GGGGGCATAAAGAAGGGGCTGGG + Intergenic
1079156835 11:17955773-17955795 AAGGGCAGAGAATAGAGGCAGGG + Intronic
1079748564 11:24164536-24164558 AAGGAAAGAAAGAAAGGGAAAGG - Intergenic
1080170952 11:29302040-29302062 AAGGAAAGAAGGAAGGGGGAGGG + Intergenic
1080885785 11:36366874-36366896 AAGGGGAGAAAGAAGGAGAGAGG - Intronic
1081179209 11:39966521-39966543 AAGGAAAGAAAGAGGTGGCAGGG - Intergenic
1081735333 11:45399563-45399585 AAGGTAAGAGAGAAGGGGCGTGG + Intergenic
1081842872 11:46215877-46215899 GAGGACAGAGAGAATGGGCAAGG - Intergenic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083173972 11:60938082-60938104 AGGGGCAGCAAGCAGGGGCCTGG - Intronic
1083176393 11:60952474-60952496 ACGGGTAGAAAGAAGTGGAAAGG + Intronic
1083264771 11:61541664-61541686 AAGGTCAGAGAGATGGGGGAGGG + Intronic
1083604500 11:63969995-63970017 ACTGGGAGAAGGAAGGGGCAAGG - Intergenic
1083649994 11:64197401-64197423 AGGCCCAGAAACAAGGGGCAAGG + Intronic
1083768860 11:64855260-64855282 CAGGGCAGAAGGAAGGCCCAGGG - Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084148064 11:67275477-67275499 TTGGGCAGGAAGAAGGGGAAGGG - Intronic
1084450645 11:69234731-69234753 AAGGGCAGGAGGAAGGGGGGGGG + Intergenic
1084586285 11:70064627-70064649 AAGGGAAGAAGGAAGAGGCTTGG - Intergenic
1084717000 11:70880418-70880440 GAGGACTGAAAGATGGGGCAGGG + Intronic
1084877143 11:72141594-72141616 GAGGGCTCAAAGGAGGGGCATGG - Intergenic
1084882303 11:72180397-72180419 GAGGGCTCAAAGGAGGGGCATGG - Intergenic
1085012786 11:73152902-73152924 GAGGGCAGGAACAAGAGGCAGGG + Intergenic
1085472816 11:76769026-76769048 GTGGGCAGGAAGCAGGGGCATGG + Intergenic
1085535817 11:77216743-77216765 AAAGGCACACAGAAGGGCCACGG - Exonic
1085550537 11:77366476-77366498 AATAGAATAAAGAAGGGGCAGGG + Intronic
1086090101 11:82996978-82997000 AAAGGAAGCAAGAAGAGGCATGG + Intronic
1086447169 11:86880002-86880024 AAGGGGAGAAAGGCGGGGAAAGG + Intronic
1086916017 11:92531143-92531165 CATGGCTGAAAGAAGGAGCAAGG - Intronic
1086974112 11:93113520-93113542 AAGGGAGAAAATAAGGGGCAGGG - Intergenic
1087052770 11:93903190-93903212 AAGGTCAGAATGCAGGGGCCAGG + Intergenic
1087411970 11:97802810-97802832 AATGGGAGAAAGAAGAGGGAAGG + Intergenic
1087479680 11:98683496-98683518 TAGGGCAGAAAGAAATGGAACGG - Intergenic
1087820791 11:102709737-102709759 ACAGGCAGAAAGAAGGAGGAAGG + Intergenic
1088674639 11:112180642-112180664 AAGGGCAGAAAGGTGGCGAAGGG + Intronic
1088720463 11:112587815-112587837 TAGGGAAGAAAAAAGGGGCTAGG - Intergenic
1088741414 11:112770427-112770449 AAGGGCAGGAAGAACGGCAATGG - Intergenic
1088988120 11:114927938-114927960 AACGGAAGAGAGATGGGGCAGGG + Intergenic
1089064336 11:115651033-115651055 CAGGATAGAAAAAAGGGGCAGGG - Intergenic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1089488997 11:118870019-118870041 AAAGGCAGAGAGAAGCGGCGAGG - Intergenic
1089665363 11:120014488-120014510 AAGAGCAGAACCAAGAGGCAGGG - Intergenic
1089789560 11:120932854-120932876 AAGGGCAGAAAGCTGGGGTGAGG + Intronic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1090082932 11:123626500-123626522 AAGAGCTTAAAGAAGTGGCATGG - Intronic
1090367302 11:126217619-126217641 AAAGGCAGGAGGAGGGGGCAGGG - Intronic
1090536414 11:127646416-127646438 GAGGGCAAAAAGGAGGGTCAGGG + Intergenic
1090654420 11:128832102-128832124 AAGGCAAGAAATAAGGTGCAAGG - Intergenic
1090944058 11:131413927-131413949 AAAGGCAGAGGGAAGGTGCAGGG + Intronic
1091046523 11:132330530-132330552 AAGGGCAGCATGCAGGGCCAAGG - Intronic
1091065360 11:132505164-132505186 AAAGGCAGAGAATAGGGGCAAGG + Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091192653 11:133707596-133707618 AAGGGAAGAAAAAAGGGGAAGGG + Intergenic
1091375594 12:22866-22888 AGGGGCAGAAAGAGGGGACAGGG + Intergenic
1091526713 12:1309596-1309618 AAAGGGAGAGAGAAGGGGGAAGG - Intronic
1092242600 12:6844410-6844432 AAGGAAAGAAAGAAAGGGCTAGG - Intronic
1092607125 12:10132795-10132817 CAGGGCAGAAAGACGGGGAAAGG - Intergenic
1093019711 12:14192144-14192166 AAGGGGAAAAAGAAGAGGAAAGG + Intergenic
1093141626 12:15516549-15516571 GAGGGAAGAAGGAAGGGGGAGGG + Intronic
1093621624 12:21297186-21297208 AAGGAAAGAAAGAAAGGGTAGGG - Intronic
1093867298 12:24244110-24244132 AAGAGCAGAAAGAAAAGGCTGGG + Intergenic
1094039510 12:26108271-26108293 ACTGGCAGAAAGAAGGGCAAGGG + Intergenic
1095226867 12:39687543-39687565 AAGGGCAGTACCAAGGGGGATGG + Intronic
1095712889 12:45308950-45308972 AAGGGAAGAAAGAAGAGGGTTGG + Intronic
1096346246 12:50849537-50849559 AAGGGCTGGATGCAGGGGCAGGG - Intronic
1096390451 12:51224687-51224709 AAGGAAAGAAAGAAAAGGCAAGG - Intergenic
1096585257 12:52615740-52615762 CAGGGGAGAAAGAAGGCACATGG + Intronic
1096626224 12:52897674-52897696 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1096786999 12:54022675-54022697 AGGGGGAGAAAGAGGGGGAAAGG + Intronic
1096976203 12:55700482-55700504 AGGGCTAGAAAGAAGAGGCAGGG - Intronic
1097235477 12:57536437-57536459 AGGGACAGGGAGAAGGGGCAAGG + Intronic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1097941348 12:65309869-65309891 AAGGGCAAATAGAAGAGGTAAGG + Intronic
1098129012 12:67328650-67328672 AAATGAAGAAAAAAGGGGCAGGG - Intergenic
1098133684 12:67378890-67378912 AAGGGGAGAAAGATGAGGCTGGG - Intergenic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1099021968 12:77417233-77417255 AAGGGCAGAGAAAAGAGTCAAGG + Intergenic
1099603809 12:84776037-84776059 AAAGGAAGCAAGAAGAGGCAAGG - Intergenic
1099731277 12:86506843-86506865 GAAGGCAGAAAGAAGGGGTAAGG + Intronic
1099769666 12:87034739-87034761 AATGGCAGTAAGAAGGCGCTAGG - Intergenic
1100390972 12:94146629-94146651 GAGGGGAGGAAGAAGGGGAAAGG - Intergenic
1100402521 12:94244902-94244924 AGGGGAAGAAAGAATGGGGAAGG - Intronic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100780690 12:98023032-98023054 AAGAGCAAACAGAAGAGGCAAGG - Intergenic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101059438 12:100955515-100955537 AAAGGCAGAATGAAGGGGAAGGG + Intronic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1101452064 12:104788945-104788967 AGGGGCAGAAAGCAGGGGCAAGG + Intergenic
1101684269 12:107001641-107001663 TAGGAGAGAAAGAAAGGGCAGGG - Intronic
1101710047 12:107256738-107256760 GAGGGCTAAAGGAAGGGGCAGGG - Intergenic
1101897155 12:108765522-108765544 AACGGCAAGAAGAAGGGGCGGGG - Intergenic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102423438 12:112822150-112822172 AGGGGAAGAGACAAGGGGCAAGG + Intronic
1102615770 12:114152750-114152772 AAGGGAAGACAGAAGGGCTAGGG + Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102821828 12:115915076-115915098 AGGGGGAGAAAGGAGAGGCAAGG + Intergenic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103624010 12:122205100-122205122 GAGGGGAGAAAGAAGGGAGACGG - Intronic
1103800958 12:123536874-123536896 AAAGGAAGAAAGAAAGGGGAGGG - Intergenic
1103986258 12:124769543-124769565 AAGGGCATGGGGAAGGGGCATGG - Intergenic
1104044171 12:125150051-125150073 ACAGAGAGAAAGAAGGGGCATGG - Intergenic
1104218747 12:126761270-126761292 CATGGCAGAAAGAAGAGGGAAGG - Intergenic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105618816 13:22047160-22047182 AGGGGCAGAGAGAAGGGGAGAGG + Intergenic
1105677512 13:22688180-22688202 AAGGACAGAAAGAAAAGGGAAGG + Intergenic
1105734208 13:23251087-23251109 AAGAGAAGAAAGAACGGGGAGGG - Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106189630 13:27439762-27439784 AAGGGAAGAGATAATGGGCAGGG + Intronic
1106388933 13:29316529-29316551 AAGGAAAGAAGCAAGGGGCAGGG - Intronic
1106768325 13:32938290-32938312 AAAGAAAGAAAGAAGGGGCGGGG - Intergenic
1107352075 13:39525617-39525639 AAGGTCAAAAAGAAGATGCAAGG - Intronic
1107455601 13:40551927-40551949 AAGGGCAGAAGGAAGGGGAGGGG - Intergenic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108354506 13:49618282-49618304 AAAGGCAGGAAGAAAGGGAAAGG - Intergenic
1108902161 13:55424992-55425014 AAGGGCAGAAAGGCAGAGCAAGG + Intergenic
1109176851 13:59167670-59167692 AAGGGAAGAATGAAGGGAAAGGG - Intergenic
1109253577 13:60050391-60050413 AAGGACAGACAGAAAAGGCAGGG + Intronic
1109552147 13:63917739-63917761 AAGGAAGGAAAGAAGGGGAAGGG - Intergenic
1109552185 13:63917879-63917901 AAGGAAGGAAAGAAGGGGAAGGG - Intergenic
1110356225 13:74570964-74570986 AAGGGGAGAAAGAAGAGCAAGGG + Intergenic
1110582882 13:77152721-77152743 AAGGGGAGCTAGAAAGGGCATGG - Intronic
1111217781 13:85166407-85166429 AAGGGGAGAAAACAGGGCCAGGG - Intergenic
1111340683 13:86881916-86881938 AAGGACAGAGAGAAGAGGCAGGG - Intergenic
1111472424 13:88700428-88700450 CAGGGCAGAAAGAAGTGAAATGG - Intergenic
1112213899 13:97410322-97410344 AAAAGCAGAAAGAAGAGACATGG - Intergenic
1112613953 13:100984176-100984198 AAAGGCAGGGAGAAGTGGCAGGG + Intergenic
1112721536 13:102251557-102251579 AAGGACAAAAACAAGGGGCGAGG + Intronic
1112918328 13:104578503-104578525 AAGCTCAGAAAGAGGGTGCAAGG - Intergenic
1113109581 13:106807896-106807918 AAGGGCAGAGAGTAGGTGAAGGG - Intergenic
1113341032 13:109426392-109426414 AAGGAAGGAAGGAAGGGGCAGGG - Intergenic
1113609853 13:111636666-111636688 AAAGACAGAAAGTGGGGGCAAGG - Intronic
1113969626 13:114178942-114178964 AAGGGCAGAAGAAAGAGGTAGGG + Intergenic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114667610 14:24389272-24389294 ACCGGCAGAAAGAAGTCGCATGG - Intergenic
1114916060 14:27266759-27266781 AAGTGCAGAAACAAGTGGAAGGG + Intergenic
1115159766 14:30380675-30380697 ACGGGCAGCGAGAAGGGGCAAGG + Intergenic
1115582161 14:34771843-34771865 AAGGAGAGAAAGAAGAGGGAAGG + Intronic
1115791260 14:36881577-36881599 ATGGGTAGAAAAAAAGGGCAAGG - Intronic
1116752881 14:48909095-48909117 AGGGGAAGAAAGAAGGAGAAAGG - Intergenic
1116792501 14:49354340-49354362 GAAGGAAGAAAGAAGGGGCTGGG + Intergenic
1116825360 14:49668285-49668307 AAGGGAAGGAGGAAGGGGGAAGG + Intronic
1117152736 14:52905737-52905759 AAGGGCAGAAAGGAGGGAAGAGG + Intronic
1117845841 14:59911293-59911315 ACGGGCAGAAGGAAGGAGTAAGG - Intergenic
1118015133 14:61652822-61652844 AAGGGCAGAGGCAAGGGGCAGGG - Intronic
1118456939 14:65953211-65953233 CATGGCAGGAACAAGGGGCAGGG - Intergenic
1119179924 14:72598817-72598839 AAGGGGAGAAGGAATGGGCCAGG - Intergenic
1119328291 14:73775222-73775244 AAGGCCAGAAAGGTGGGCCAGGG + Intronic
1119651853 14:76389485-76389507 AGAGGCAGAAAGAAGGGCCTGGG + Intronic
1119722580 14:76901171-76901193 GAGGGCAGAAAGGAGAGGGAGGG + Intergenic
1119726125 14:76922784-76922806 AAGGGAAGGACGAAGGGGGAGGG - Intergenic
1119758088 14:77132899-77132921 AAGGCAAGGAAGAAGGGACAGGG - Exonic
1119870441 14:78012339-78012361 AAGGAAAGAAGGAAGGGGAAGGG - Intergenic
1119950167 14:78737037-78737059 AAGGGAAGGAGGAAGGGGAAAGG - Intronic
1120030771 14:79638145-79638167 CAGGCTAGAAAGGAGGGGCATGG - Intronic
1120920696 14:89752801-89752823 AAATGCAGCAAGAAGGAGCAAGG - Intergenic
1121059302 14:90889862-90889884 CAGTACAGAAAGAAGGAGCAAGG - Intronic
1121098348 14:91233444-91233466 AAGGAAAGAAAGAGGGGGGAAGG - Exonic
1121118981 14:91364089-91364111 AATGGCAGAAACAAGTGCCAAGG + Intronic
1121657092 14:95605080-95605102 AAGGGAGAAAAAAAGGGGCAGGG - Intergenic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122253907 14:100462965-100462987 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122253923 14:100463020-100463042 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122848778 14:104515384-104515406 AAGGGCAGAGAGAAGTGGGTGGG + Intronic
1123093634 14:105753760-105753782 CAGGGCAGAAGGGAAGGGCAGGG - Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1123971230 15:25509735-25509757 GAGGGGAGAGAGAAGGGCCAGGG + Intergenic
1124163972 15:27301889-27301911 GAGGCCAGAAAGAAGAGGCATGG + Intronic
1124360946 15:29036105-29036127 AAGGACACAAGGGAGGGGCAAGG - Intronic
1124556510 15:30730958-30730980 CAAGGCAGAAAGAAGGGGAAAGG + Intronic
1124612245 15:31216244-31216266 AGGGGCAGAAGAAGGGGGCAAGG + Intergenic
1124632982 15:31347751-31347773 AAGGGCAGACAGAAGAGGTTGGG - Intronic
1124647672 15:31450433-31450455 AAGGGAAGGAAGACGGGGAAGGG + Intergenic
1124867831 15:33510815-33510837 AAGGACAGTAAGGAGGGGAAAGG - Intronic
1124888661 15:33711215-33711237 AATGAAAGAAAGAAGTGGCATGG - Intronic
1125004324 15:34800146-34800168 AGGGGAAGGAGGAAGGGGCACGG + Intergenic
1125037962 15:35149065-35149087 AAGGGAGGAGAGAAGGGGGATGG - Intergenic
1125104818 15:35958186-35958208 AGGGGGAGAAGCAAGGGGCAGGG - Intergenic
1125599090 15:40906049-40906071 AGGAGAAGACAGAAGGGGCAGGG - Intergenic
1125798328 15:42421343-42421365 CAGGGCAGAGAGGAGTGGCAGGG + Intronic
1125947681 15:43723305-43723327 AAAGAAAGAGAGAAGGGGCAGGG + Intergenic
1126321478 15:47428961-47428983 AAGGGCCGAAAGAAGGAGGGAGG + Intronic
1126445137 15:48734250-48734272 AATAGCACAAAGGAGGGGCAAGG + Intronic
1126882744 15:53116929-53116951 AAGGGAAGAAAGAAAGAGCAAGG - Intergenic
1127267570 15:57374255-57374277 AAGGAGAGAGAGAAGGGGAAGGG - Intergenic
1127649358 15:60992182-60992204 AATGGCACAAAGAAGGCCCACGG + Intronic
1128304178 15:66587096-66587118 AAGGGGAGAAGGAAGAGGAAGGG - Intronic
1128390624 15:67180248-67180270 AAGGGCTGAGAGAATGGGCCTGG + Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1128649489 15:69400212-69400234 AAGGGCAGAGAGAGAGGCCAAGG + Intronic
1128689211 15:69710485-69710507 AAGGGCAGAAGCAAGGGCCAGGG + Intergenic
1129131729 15:73504522-73504544 ATGGGCAGGAAGGAGGGGCTAGG - Intronic
1129506877 15:76088801-76088823 AAGGGAAAAAAGGCGGGGCATGG + Intronic
1129514918 15:76151515-76151537 AAGAGCAGAAACACAGGGCAGGG - Intronic
1129889980 15:79065538-79065560 ATTGGCAGGAGGAAGGGGCAGGG + Intronic
1129905268 15:79182807-79182829 AAGGGAAGAAAGAAAGAGAAAGG - Intergenic
1130248502 15:82277199-82277221 AAGGCAAGAAATAAGGGGTATGG + Intronic
1130730949 15:86491607-86491629 AGGGACAGAAAGAAAGGGTATGG + Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131287150 15:91069784-91069806 AAGGGAAGAATGCGGGGGCAGGG - Intergenic
1131352356 15:91712849-91712871 AAGGACAAAAAGAAGGGGTTTGG - Intergenic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1131511555 15:93051939-93051961 CAGGGCAGAGACAAAGGGCAGGG + Intronic
1131928286 15:97410518-97410540 AAAGGCAGGAAGTAGGGGCCAGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132214229 15:100050820-100050842 CAGGGCACATAGAAGGGTCATGG - Intronic
1132267883 15:100492973-100492995 AAGAGCACAAAGAAGGGGACGGG - Intronic
1132839706 16:1973007-1973029 AAGGAAAGAAAGCAGAGGCAAGG + Intronic
1133047376 16:3096306-3096328 AAGGGCAGAAAGCAGAGGGCAGG - Intronic
1133214526 16:4283547-4283569 AAGGGTAGGAAGAAGGGGCCAGG - Intergenic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1134264725 16:12683380-12683402 AAGGGACGAGAGAAGGGGAATGG - Intronic
1134332349 16:13262706-13262728 AAGGAAAGAAGGAAGAGGCAGGG + Intergenic
1134464006 16:14456910-14456932 AAGGACATAAATAAGAGGCAAGG - Intronic
1134673696 16:16074551-16074573 TAGGGCAGGAAGGAGGGGCTGGG - Intronic
1135088122 16:19490910-19490932 GAAGGGAGAAAGAAGGGGAAGGG - Intronic
1135404978 16:22191080-22191102 GAGGGAGGAAAAAAGGGGCAGGG - Exonic
1135708712 16:24696862-24696884 CAAGGCAAAAAGAAGGGGAATGG - Intergenic
1135772802 16:25229943-25229965 AACACCAGAAAGAAGGGCCAGGG + Intergenic
1135891773 16:26363778-26363800 AAGGAAGGAAAGAAGGGACAAGG - Intergenic
1135920296 16:26643415-26643437 AAGGAAAGAGAGGAGGGGCAGGG - Intergenic
1135928857 16:26719492-26719514 AAGGGTTGAGAGAAGGGGAAAGG - Intergenic
1136187670 16:28597576-28597598 GTGGGCAGAGTGAAGGGGCAGGG + Intergenic
1136190149 16:28610556-28610578 GTGGGCAGAGTGAAGGGGCAGGG + Intronic
1137400083 16:48146271-48146293 AAGGACAGAAGGGAGGGCCAGGG - Intronic
1137708142 16:50549046-50549068 GGGGGCAGGAAGAGGGGGCAGGG - Intronic
1137770265 16:51010763-51010785 AAGGGCAGAAAAAAAGGGTTGGG - Intergenic
1138207824 16:55137816-55137838 AAGGAAAGAAAGAAAGGGAAAGG + Intergenic
1138503011 16:57460125-57460147 AATGGGAGAGAGGAGGGGCAGGG - Intronic
1139320396 16:66109659-66109681 AAGGGAAGAAGGAAGGGGAGGGG + Intergenic
1139483696 16:67244805-67244827 TAGGGCAGAAATAAGAGGAAGGG - Intronic
1139662306 16:68429532-68429554 GAGGGCAGAAAAAAGGAGCTTGG + Intronic
1140036531 16:71375695-71375717 AAGGGCAGCAGGAAAAGGCAGGG + Intronic
1140172456 16:72620287-72620309 ATAGGCAGAAAGAAGGGTGACGG + Intergenic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1141118954 16:81335955-81335977 AAGGGCATAAGGCAGGGGAAGGG - Intronic
1141249981 16:82346908-82346930 AAGGACAGAGAGGAGGAGCAGGG + Intergenic
1141441311 16:84031467-84031489 AAGGGCAGAGAGCATGGGCGGGG - Intronic
1141665101 16:85461894-85461916 GAGAGCAGGAAGGAGGGGCAGGG - Intergenic
1141827071 16:86488045-86488067 ATGGGCACAGAGAAAGGGCACGG - Intergenic
1141864508 16:86740919-86740941 AAGGGCCCAGAGAAGAGGCACGG - Intergenic
1141918982 16:87122257-87122279 AAGGGGAGACGGAACGGGCAGGG - Intronic
1142141214 16:88473648-88473670 AAGGGCTGATAGATGGGGCGGGG - Intronic
1142666170 17:1465126-1465148 TAAGGCAGAAAGAAGGGGGCAGG + Exonic
1143411505 17:6712311-6712333 AAGGGCTGAAAGAAGGAACGAGG + Intronic
1144057114 17:11553272-11553294 AAGTGCAGAAGGCAGAGGCAGGG + Intronic
1144239909 17:13300458-13300480 ATGGGCAGATGGAAGGCGCAAGG + Intergenic
1144816963 17:18041079-18041101 AAGGGCAAAGGGAAGGGGAAAGG - Intronic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1145256909 17:21330453-21330475 AAAGGCAGAATGAAGGGCCCTGG + Intergenic
1145938873 17:28730955-28730977 AAGGAAAGAAAGAAGGGGCCGGG + Intronic
1145999232 17:29121481-29121503 AAGGGCAGAGAGCCAGGGCAGGG + Intronic
1147476163 17:40713470-40713492 AATGGGAGGGAGAAGGGGCAGGG - Intergenic
1147632756 17:41942691-41942713 CAGGGCAGAAAGATGTGGCAGGG + Intronic
1147977201 17:44254693-44254715 AAGGGCAGGAGGATGGGGAAGGG + Intronic
1148018827 17:44540281-44540303 AAGAGCACAAAGAAGGGGGCTGG + Intergenic
1148290326 17:46441764-46441786 AGGGGCAGAAAGAAAGGTAAGGG - Intergenic
1148312494 17:46659337-46659359 AGGGGCAGAAAGAAAGGTAAGGG - Intronic
1148758265 17:49985966-49985988 AAGGGGAGAATGGAGGGGGAAGG - Intergenic
1149042635 17:52208341-52208363 AAGGAAAGAAAGAAAGGGAAGGG - Intergenic
1149258102 17:54849783-54849805 AAGGGAAGAATCAAGGGGGAAGG + Intergenic
1149376276 17:56047359-56047381 AGGGGGAGAACGAAGGAGCACGG + Intergenic
1149529680 17:57384969-57384991 AAAGGCAGAAAGGAGGGAGAGGG - Intronic
1150269719 17:63855914-63855936 AGAGGCATAAAGAAGAGGCATGG + Intergenic
1150323234 17:64234057-64234079 GAAGGCAGAAATAAGGGGTAAGG + Intronic
1151191315 17:72400095-72400117 AAAGGGACAGAGAAGGGGCAGGG - Intergenic
1151326011 17:73380169-73380191 AGGGGAAGGAAGCAGGGGCAGGG - Intronic
1151685913 17:75646500-75646522 AAGGGCAGAAAGGAGCTGAAGGG + Exonic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152791818 17:82284162-82284184 AAAGGCAGAAAGCAGGGGCCGGG + Intergenic
1153388502 18:4527803-4527825 TAGGGCAGATGGAAGGGGGAGGG + Intergenic
1153565462 18:6414241-6414263 AAGGGCAGAAAGCGGGTGGAGGG + Intronic
1155100717 18:22607564-22607586 AAAGGCAGCAAGAAAGGGCCTGG - Intergenic
1155450835 18:25960992-25961014 AAGGCAAGAAAGAAATGGCAAGG + Intergenic
1155500088 18:26479354-26479376 AAGGGCAGCAAGAAAGGCCCAGG + Intronic
1155590406 18:27420981-27421003 AAGGGCAGAGGGAAGGGGTGGGG - Intergenic
1155681488 18:28492119-28492141 AAGTGCAGAGTGAAGTGGCAGGG - Intergenic
1156337957 18:36186874-36186896 AAGGGCAGGAAGTAGGGCCCAGG + Intergenic
1156514277 18:37666993-37667015 TAGGACAGAAATAAAGGGCAGGG + Intergenic
1156761794 18:40601030-40601052 AAGGGCAGAAGGGAGGGGAGGGG - Intergenic
1156768547 18:40689628-40689650 CAGGGCAGAAAGAGGAGGAAAGG - Intergenic
1156836540 18:41561915-41561937 GAGGAGAGAAAGAATGGGCAGGG - Intergenic
1158548261 18:58414073-58414095 AAAGCCAGAACGCAGGGGCAGGG + Intergenic
1158649565 18:59273485-59273507 AGGGGCCGAGAGAAGGGGCTGGG - Intronic
1158852035 18:61504215-61504237 AAGGGCAGAGACTAGGAGCAGGG + Intronic
1158960912 18:62587132-62587154 AAGATCAGAAAGAATGGGGAGGG + Intronic
1159677206 18:71299694-71299716 AAAGGAAGAAAGAAGGGGAGAGG - Intergenic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1160187581 18:76687594-76687616 ACAGGCACACAGAAGGGGCAGGG + Intergenic
1160788460 19:912399-912421 AAGACCAGAGAGTAGGGGCACGG + Intronic
1161404032 19:4081895-4081917 AAGAGCAGGGAGGAGGGGCAGGG - Intergenic
1161666205 19:5578598-5578620 AAGGGGAGAAAAAAGAGGGATGG - Intergenic
1162228249 19:9242844-9242866 GAGGGAAGAAAGAAGAGGAAAGG - Intergenic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1162873698 19:13604785-13604807 AAGGGAAGGAGGAAGGGGAAGGG + Intronic
1163375288 19:16926609-16926631 AAAGAAAGAAAGAAGGGGCCAGG - Intronic
1163454000 19:17395274-17395296 AAGGAGGGAGAGAAGGGGCAGGG - Intergenic
1163496151 19:17647693-17647715 AAGGGCAGGACGCAGGGACATGG - Intronic
1163879053 19:19901636-19901658 ATGGGGAAAAAGAAGGGGTAGGG - Intronic
1164680396 19:30130734-30130756 AAAGGGAGAAGGAAGGGGGAGGG - Intergenic
1164705341 19:30315200-30315222 ATGGGGAGAATGAAGAGGCATGG + Intronic
1164749105 19:30638159-30638181 AAGGGCAGAAAGCCAGGCCAGGG + Intronic
1164834296 19:31347963-31347985 AAGGGCAGAGAGTAGGGTCAGGG - Intronic
1164852986 19:31500222-31500244 AAGGGCAGGGATAAGGAGCAGGG + Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165022338 19:32935117-32935139 GAGGGCAGAAAGGCAGGGCAGGG + Intronic
1165888847 19:39098822-39098844 GAAGGCAGACCGAAGGGGCATGG + Intronic
1165937436 19:39397873-39397895 GGGAGCAGGAAGAAGGGGCAGGG - Exonic
1165941976 19:39419160-39419182 AAGGTCACAAAGCAGGGACATGG - Intronic
1166654423 19:44599762-44599784 AAGGGAAAGAAGAATGGGCATGG + Intergenic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166846305 19:45730749-45730771 CAGGGGCGAAAGAAGGGGCTGGG - Intronic
1166954542 19:46454601-46454623 AAGGAAGGAAAGAAGGGGAAGGG - Intergenic
1167117012 19:47494120-47494142 GAGGGCAGTAGGAAAGGGCAAGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1168510156 19:56967362-56967384 AGGAGGAGAAAGAGGGGGCAGGG - Intergenic
1168591926 19:57643483-57643505 AAGCATAGAAAGAAGGGGCGGGG + Intergenic
1168641003 19:58031593-58031615 AGGGGCTAGAAGAAGGGGCAAGG - Intergenic
1168719115 19:58545123-58545145 AAAGGCAGAGAGTAGGGGGAGGG - Intronic
1202670956 1_KI270709v1_random:51040-51062 AATGGCAGAATGAAGCAGCAAGG + Intergenic
924978270 2:197447-197469 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978281 2:197499-197521 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978298 2:197603-197625 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978309 2:197655-197677 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978320 2:197707-197729 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978331 2:197759-197781 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978352 2:197863-197885 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978363 2:197915-197937 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978374 2:197967-197989 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978385 2:198019-198041 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978396 2:198071-198093 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978427 2:198227-198249 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978438 2:198279-198301 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978449 2:198331-198353 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978460 2:198383-198405 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978471 2:198435-198457 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978482 2:198487-198509 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
925212331 2:2060679-2060701 AAGGGCAGAGAGGAGGGGAGGGG - Intronic
925379678 2:3416564-3416586 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379686 2:3416587-3416609 GAGGGCATAGTGAAGGGGCAGGG - Intronic
925379695 2:3416611-3416633 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379703 2:3416634-3416656 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379712 2:3416658-3416680 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379728 2:3416704-3416726 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379737 2:3416728-3416750 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379755 2:3416774-3416796 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379764 2:3416798-3416820 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379782 2:3416844-3416866 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379791 2:3416868-3416890 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379800 2:3416892-3416914 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925493101 2:4417858-4417880 AATAGCTGAGAGAAGGGGCAGGG - Intergenic
925506282 2:4568818-4568840 AAGGACTGAAAGAAAGGGAAGGG - Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
926078731 2:9965997-9966019 CAGGGAAGAAGGCAGGGGCAAGG - Intronic
926301740 2:11609716-11609738 ATGGTCAGGAAGAAGGAGCAGGG + Intronic
926335119 2:11857190-11857212 AGGGGCAGAAACACGGGGCAGGG + Intergenic
926553218 2:14325615-14325637 AAGGGAGGAAAGAAGGAGAAGGG + Intergenic
927179341 2:20433420-20433442 AAGGGCAACAAGAAAGGGCGAGG + Intergenic
927197118 2:20555654-20555676 AAGGGAGGAAGGAAGAGGCAGGG - Intergenic
927573356 2:24179714-24179736 CAGGGCAGGAGGAAGGGGTAAGG + Intronic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
928440257 2:31286191-31286213 AAGGCCAGGGTGAAGGGGCATGG + Intergenic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928921364 2:36531711-36531733 AAGAGGAGGAAGAAGCGGCAAGG - Intronic
929123654 2:38503592-38503614 AAGGGCAAAAGGAAAGAGCAAGG - Intergenic
929309472 2:40405757-40405779 AAGGGAAGAAAGAATAGCCAAGG - Intronic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929505571 2:42525502-42525524 AAGGGAAGAAAGGAAGGGGAAGG - Intronic
930084059 2:47480214-47480236 AAGGGAAGGAGGAAGGGGGAAGG - Intronic
930084067 2:47480233-47480255 AAGGGAAGGAGGAAGGGGGAAGG - Intronic
930277595 2:49331770-49331792 AAGGAATGAAGGAAGGGGCAAGG + Intergenic
930288528 2:49465358-49465380 AAGGGCAGAGGGAAAGGGGAAGG - Intergenic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930433078 2:51305375-51305397 GAGGGCAGAAAGAGGGGGGTGGG + Intergenic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930871773 2:56178409-56178431 GAGGAAAGAAAGAAGGGGGAAGG - Intergenic
931628465 2:64277776-64277798 AAGGGAGGAAGGAAGGGGAAGGG - Intergenic
931732425 2:65165132-65165154 CAGAGCAGAAAGGAGGAGCAAGG - Intergenic
931865043 2:66400216-66400238 AAGGGGACAAGGAAGGGGCAAGG + Intergenic
931907063 2:66854030-66854052 AAAAGCAGAAAGAAAAGGCAGGG - Intergenic
932117558 2:69067134-69067156 AAGGGCAGAGAGTAGGGAGATGG + Intronic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
932591069 2:73068079-73068101 ACGGGCAGAAAGAGGGTGGAGGG - Intronic
932696975 2:73964968-73964990 AAGGGCACAAAGACTGGACATGG - Intergenic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933108060 2:78358498-78358520 AACAGCAGAAAGAAAGGGAAGGG - Intergenic
933200663 2:79444550-79444572 AAAGGCAGACAGAAGCAGCAAGG - Intronic
933250632 2:80024964-80024986 AAGGGGAGCTGGAAGGGGCAAGG + Intronic
933260643 2:80127602-80127624 AGGGGCAGGAAGAAGGGGCTAGG - Intronic
933728234 2:85438252-85438274 CAGGGCACCAGGAAGGGGCACGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934521141 2:95020906-95020928 CAGGGCAGAAGGAACAGGCATGG - Intergenic
934563930 2:95328056-95328078 AGGGGAAGAGAGCAGGGGCAAGG + Intronic
935039274 2:99410403-99410425 ATGGACAGAAAGAAAGGGCAAGG - Intronic
935088819 2:99874665-99874687 CAGGGCAGAAGGTTGGGGCATGG + Intronic
935098531 2:99970298-99970320 AAGGGGAGAAAGGATGGTCAGGG - Intronic
935326734 2:101944312-101944334 ACGGGGAGAGAGTAGGGGCATGG + Intergenic
935441222 2:103098204-103098226 AAGAGCAGAAAAAGAGGGCAGGG + Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936553267 2:113469414-113469436 CAGGTCACAAACAAGGGGCACGG - Intronic
936965999 2:118128109-118128131 AGGGACAGAGAGAAGGGGCAGGG - Intergenic
936975161 2:118211961-118211983 AAGGCCAGAAGAAAGTGGCACGG + Intergenic
937263282 2:120600141-120600163 AAGGGCAGGGACAAAGGGCAGGG - Intergenic
937333078 2:121044236-121044258 AAGGGAAGAGGGAAGGGGCAGGG + Intergenic
937341028 2:121090621-121090643 AGAGGCAGAGAGAAGGGGGAAGG + Intergenic
937665964 2:124487024-124487046 AAACGTAGAAAGAAGTGGCAGGG - Intronic
937765082 2:125651836-125651858 AAAGGAAGAAAGAAGAGTCAGGG - Intergenic
937942947 2:127302400-127302422 ATGGGAAGGAAGAAGGGGAAAGG - Exonic
938115451 2:128600161-128600183 AAGGGCAGAAGGAAGGAGGGAGG + Intergenic
938219640 2:129554480-129554502 AATGGGAGGAAGAAGAGGCAGGG - Intergenic
938398392 2:130967309-130967331 CGGGGCAGAAAGAAGGGCCATGG - Intronic
938677039 2:133647450-133647472 AACGAAAGAAAGAAAGGGCAAGG + Intergenic
939129172 2:138213651-138213673 AATGGAAGATAGAAGGGACATGG + Intergenic
939194940 2:138960308-138960330 AAGGGAAGAAGAAAGGGGCAAGG - Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
942327400 2:174787703-174787725 GAGGATAGGAAGAAGGGGCAGGG - Intergenic
943003406 2:182358942-182358964 AAGGGAAGGAAGAAAGGGAATGG - Intronic
943367731 2:186981743-186981765 AAGGCCAGAAAGAAAGGGCAGGG - Intergenic
944192429 2:197017887-197017909 TAGGGCAGCAAGGAGGGGAAGGG - Intronic
944872463 2:203927954-203927976 GAGAGCAGAAAGATTGGGCAGGG + Intergenic
944972132 2:205005121-205005143 AAGGGGAGGAAGACAGGGCAAGG - Intronic
945282652 2:208050512-208050534 ATGGGCAGAAAGAAAGGGACGGG + Intergenic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946057854 2:216917286-216917308 AAAAGCAGAAAGAAGGGGAGTGG - Intergenic
946142879 2:217706564-217706586 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142891 2:217706594-217706616 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142899 2:217706612-217706634 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142907 2:217706630-217706652 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142915 2:217706648-217706670 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946513802 2:220389358-220389380 AAGGAAAGAAAGAAGGGAGAGGG - Intergenic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
946860671 2:223997692-223997714 AATGGCAGAAGCAAGAGGCATGG + Intronic
947030004 2:225782859-225782881 AAGGGAGGAAGGAAGGGGAAGGG - Intergenic
947219290 2:227777735-227777757 AAGGAAAGAAAGAAGGTGGAAGG - Intergenic
947469082 2:230383506-230383528 GAAGGAAAAAAGAAGGGGCATGG + Exonic
947493902 2:230619066-230619088 AAAGGAAGAAAGAAAGGGAAAGG + Intergenic
947628176 2:231634451-231634473 AAAGAAAGAAAGAAGGGGGAGGG + Intergenic
948238175 2:236406245-236406267 GAGGGCAAGAAGAAGGCGCACGG - Intronic
948441236 2:237991157-237991179 AAAGAATGAAAGAAGGGGCAGGG - Intronic
948448026 2:238048723-238048745 GAGGCCAGAAGGAAGTGGCATGG + Intronic
948531638 2:238611718-238611740 AGGGGGAGAAAGAGTGGGCAGGG + Intergenic
948606724 2:239140706-239140728 CAGGTCAGAAGGAAGGGACATGG + Intronic
948657764 2:239487202-239487224 AAGGGCTGAAAGGAGGGACACGG + Intergenic
948783619 2:240339911-240339933 AAGGGAAGAAGCAAGGGGCTGGG - Intergenic
948821906 2:240554192-240554214 AAGTGCATCAAGATGGGGCAGGG - Intronic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1168849722 20:968152-968174 CAGGGCAGAAGGAGGGGGAAAGG + Intronic
1169187673 20:3632394-3632416 AAAGGCAGAGAGAAGGGTGAGGG - Intronic
1169217067 20:3800178-3800200 AAGGGCAAAGACAAGGGCCAAGG - Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169469442 20:5871570-5871592 AATGGCAGAAAGAAGATGGATGG + Intergenic
1169492897 20:6086161-6086183 AAGGACACAAAGAAGTGCCATGG + Intronic
1169539773 20:6586725-6586747 AAGGAAAGAAGGAAGGGACAAGG + Intergenic
1169544334 20:6635266-6635288 AAGGAAAGAAAGAAGGGGCAAGG - Intergenic
1169773760 20:9229847-9229869 GAGGGCAGGAAGTAGGGGGAGGG - Intronic
1169852308 20:10065474-10065496 AAAGGCAGAAAGAAAAGGGAAGG + Intergenic
1169871878 20:10256720-10256742 AATGGCAAAAAGAAAGGGAATGG + Intronic
1169999951 20:11604776-11604798 CAAGGCAGAAAAAAGGGACATGG + Intergenic
1170461608 20:16581880-16581902 AATGGCAGAAAGAAAGGCTATGG - Intergenic
1170655856 20:18287643-18287665 AAGGGCAGTGAGAGGGTGCACGG + Intergenic
1171085527 20:22235161-22235183 AAGGGAAGAAGGACTGGGCAAGG - Intergenic
1171245831 20:23608767-23608789 AAAGGAAGACAGCAGGGGCAGGG + Intergenic
1172320002 20:33989008-33989030 CAAGGCAGAAAGCAGGGACAAGG + Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172450523 20:35019419-35019441 GAGGGCAGAAAGAGGAGACAGGG + Intronic
1172493749 20:35362973-35362995 AAGAAAAGAAAGAAGGGGGAAGG - Intronic
1172626390 20:36349945-36349967 CAGGGCGGAAACACGGGGCAGGG - Intronic
1173002048 20:39111647-39111669 AAGGGGAGGAGGAAGGGGGAGGG + Intergenic
1173116926 20:40253024-40253046 AAGTGCAGAGCAAAGGGGCAGGG - Intergenic
1174052246 20:47774875-47774897 AAGGGCAGAAAGAAAAAGCAGGG + Intronic
1174338613 20:49882413-49882435 AAGGAGAGAAAGGAGGAGCATGG - Intronic
1174358269 20:50012450-50012472 AGGGGCAAAGAGAAGGGCCAAGG - Intergenic
1174420544 20:50396512-50396534 AATGGCAGGAAGAAGGGTCAAGG - Intergenic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1174859583 20:54077950-54077972 AGGGGCTGACAGAAGGGGAATGG + Intergenic
1175587778 20:60159020-60159042 AAGGGGAGAAAGAACGGGAAAGG + Intergenic
1175829032 20:61952007-61952029 CAGGGCAGACAAAAGAGGCATGG + Intergenic
1175947607 20:62566006-62566028 ATGAGCAGAGGGAAGGGGCATGG + Intronic
1176195863 20:63836122-63836144 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195932 20:63836312-63836334 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1178503936 21:33148116-33148138 AAGGGAAGAATGAAGGGGCAGGG + Intergenic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178612759 21:34099660-34099682 AAGAGCAGAAAGAAGGTAGAGGG - Exonic
1178723048 21:35027122-35027144 AAGGGCAGGGTGGAGGGGCAGGG + Intronic
1178791590 21:35705176-35705198 AAGGAAAGAAGGAAGGGGGAGGG + Intronic
1178837911 21:36113867-36113889 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
1179136937 21:38687900-38687922 GAGGGATGAAAAAAGGGGCAAGG - Intergenic
1179437924 21:41374808-41374830 AAGGGCATGAAGAAGAGGTAAGG - Intronic
1179614362 21:42572203-42572225 AAGGTCAGAAAGCAAGGGCTGGG - Intronic
1179646971 21:42782055-42782077 GAGGGGAGAAAGGAGAGGCAGGG - Intergenic
1179880601 21:44291911-44291933 AAGGGCAGAAAGAGACGGCAAGG - Intronic
1179944252 21:44660171-44660193 AAGAGAAGAAAGAGAGGGCAGGG + Intronic
1181275062 22:21682994-21683016 CAGGGCAGCAAACAGGGGCAGGG - Intronic
1181275415 22:21684942-21684964 ATGGGCAGGAAGACGGGGCTTGG - Intronic
1181469659 22:23130017-23130039 AAGGAAAGAAAGAAAGGGAAGGG + Intronic
1181576406 22:23798059-23798081 TAGGGCAGGATGAGGGGGCAGGG + Intronic
1181976862 22:26736556-26736578 CAGGGAAGAAATAAGGGGAAGGG - Intergenic
1182070727 22:27461922-27461944 AGGGGCAGAAAGCAGGGAGAAGG + Intergenic
1182329778 22:29543040-29543062 AAGGGAATAAAGAAGGGGATGGG + Intronic
1182419652 22:30242773-30242795 AAGGTCTGTAAGAAGGGGCTGGG - Exonic
1182430457 22:30295852-30295874 AAGGGCACAAATTAGGGGCTGGG + Intronic
1182623685 22:31631024-31631046 AAGGCCAGGGAGAAGGGGAAGGG + Intronic
1182680714 22:32077352-32077374 AAAGGAAGGAAGAAGGGGAAAGG - Intronic
1182732863 22:32509390-32509412 AAGGGCAAAAAGGAGGGAGAGGG - Intergenic
1182739977 22:32560640-32560662 CAGGTCAGAAAGATGGGGAAGGG + Intronic
1182779956 22:32859561-32859583 AAAACCAAAAAGAAGGGGCAGGG - Exonic
1183291070 22:37002353-37002375 AAGGGCAGAAAGTAGAGGGTGGG + Intronic
1183322730 22:37175051-37175073 AAGTGCAGAGTGAAGGGGGAAGG + Intronic
1183489024 22:38106986-38107008 AGGGGCAGTAAGTAGGGGCCAGG + Intronic
1183952004 22:41357485-41357507 AAGGCCTGATAGAAGGGTCAGGG + Exonic
1184087275 22:42272430-42272452 AATGGAAGAATGATGGGGCAGGG - Intronic
1184282396 22:43445506-43445528 GATGGCAGCAAGAGGGGGCAGGG - Intronic
1184330006 22:43821362-43821384 AAGGGCAGAAGGAAGGGCACCGG + Intergenic
1185044177 22:48520695-48520717 ATGGGCAGGAAGAGGGGGCATGG + Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
949236601 3:1816809-1816831 AAGGGAAGAAAGAAAAGGAAAGG - Intergenic
949861821 3:8512517-8512539 AAGGACATGAAGAAAGGGCAAGG + Intronic
949977031 3:9470382-9470404 AAGGGCAGAAAGGAGGGGAGAGG - Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950453398 3:13078447-13078469 GAGGGGAGAAAGGAGGGGTATGG - Intergenic
950591285 3:13937200-13937222 AAGGGCAGAAAGGGCGGTCAGGG - Intergenic
951378175 3:21949518-21949540 AAGGAAAGAAAATAGGGGCATGG - Intronic
952134333 3:30399821-30399843 AAAGGAAGAAAGAAAGGGAAAGG + Intergenic
952228923 3:31408883-31408905 AAGGGCAGAATCAGGGGACAAGG + Intergenic
952904881 3:38133167-38133189 TAGGGCAGAAAGAGGAGGTAGGG + Intronic
953329764 3:42043259-42043281 AAGGGAAGAAAGAACGGGAACGG - Intronic
953442676 3:42932238-42932260 AGGATCAGAAAGGAGGGGCAAGG - Intronic
953493693 3:43369374-43369396 AAAGGTAGAAAGAATGGCCAGGG + Intronic
953860648 3:46541506-46541528 AAGGGCAAAGAGAAAGGGAAAGG + Intronic
953919288 3:46940874-46940896 ATGGGCAGAAAGAAGAGGGGAGG + Intronic
953968376 3:47327791-47327813 AAGGACTGAATGAATGGGCAAGG - Intronic
954287781 3:49631012-49631034 AAGGACAGGAAGAAGGGAGAGGG - Intronic
954330447 3:49887201-49887223 AAGGGCAGGAACAAGGTGGAGGG + Exonic
954665561 3:52249618-52249640 AGGGGCAGAGCAAAGGGGCAAGG - Intronic
954712534 3:52512262-52512284 ACAGGCAGAAAGATGGGGGAGGG + Intronic
955006626 3:54974700-54974722 AAAGGCAGCAATAAAGGGCAGGG - Intronic
955023942 3:55148976-55148998 GAGGTAAGAAAGAAAGGGCAGGG + Intergenic
955672135 3:61412741-61412763 AAGGGAAGAAGGAAAGGGAAGGG + Intergenic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
955956874 3:64299460-64299482 AAGGCCAGAAAGTAGTGGGATGG + Intronic
956281901 3:67566892-67566914 AAGGCAAGAAAGACTGGGCATGG + Intronic
956289690 3:67648402-67648424 AAGGGCAAAAAGATGGGGAAAGG + Intronic
956470484 3:69561454-69561476 TAAGGCAGTAGGAAGGGGCAGGG - Intergenic
956575788 3:70751547-70751569 GAAGACAGTAAGAAGGGGCAGGG + Intergenic
956846518 3:73188761-73188783 AAGAGAAGAAAAAAGGGGGAGGG - Intergenic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957512061 3:81201781-81201803 CAGTGAAGAGAGAAGGGGCAGGG + Intergenic
957793347 3:84967891-84967913 AATGGCAAAAAGAAGGGGAAAGG + Intronic
958128508 3:89387362-89387384 AAGTGCAGAGTGAAGTGGCAGGG - Intronic
958663355 3:97102066-97102088 AAGTCCAGAGAAAAGGGGCAAGG - Intronic
958732575 3:97974494-97974516 AAGGAAAGAAGGAAGGGGCGGGG + Intergenic
959539603 3:107523961-107523983 AAGGGGAGAGAGAAGAGGGAGGG + Intronic
959586007 3:108026103-108026125 AAGGGGGGAAAGGCGGGGCAAGG - Intergenic
959822876 3:110757156-110757178 TAGGCCAGAAAGAAGGGAGAAGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
960241788 3:115351376-115351398 AAGGGCAGATAGAAGGCATATGG - Intergenic
960445256 3:117740502-117740524 AAGGGCAGAGTGAAGGTGCTTGG - Intergenic
960688801 3:120322083-120322105 AACGGCAGAAGGAAGGGGGAAGG + Intergenic
960694568 3:120383449-120383471 GGAGGCAGAGAGAAGGGGCAGGG + Intergenic
960972497 3:123149882-123149904 GGGGGCAGAAAGGAGGGGCCTGG + Intronic
961205010 3:125075008-125075030 AAAGGCAGGAAGAAGAGGCCTGG + Intergenic
961236462 3:125372421-125372443 AAGGTCAGAAAGGAGGAGAAAGG + Intronic
961345503 3:126260850-126260872 ATGGGGAGAAAGAAGAGGGAAGG - Intergenic
961477009 3:127153257-127153279 AGGGGCAGATAGAAGGCGCTGGG + Intergenic
961478143 3:127161375-127161397 GAGAGCAGACAGAAGGGGCCAGG - Intergenic
961652490 3:128423869-128423891 CAGGGCAGAGAGAATGGCCATGG - Intergenic
961766954 3:129218925-129218947 AAAGGAAGAAAGAAAGGGAAAGG - Intergenic
962264502 3:133935473-133935495 AGCAGCAGAAAGAAGGGGCGGGG - Intronic
962267990 3:133957074-133957096 TAGAGCAGAAAGAAGGGCAATGG - Intronic
962365322 3:134775254-134775276 CAGGGCTGTAAGATGGGGCAGGG + Intronic
962403393 3:135080321-135080343 AGGGCCAGAGAGAAGGGGGAGGG + Intronic
962430676 3:135316386-135316408 AAGAGAAAAATGAAGGGGCATGG + Intergenic
962826203 3:139102582-139102604 AGGGGCAGAAAGAGTGTGCAAGG + Intronic
962991830 3:140584503-140584525 GAGGGGAAAAAGAAAGGGCATGG + Intergenic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963748730 3:149152387-149152409 AAAGGCAGAATGAAGGAACAAGG + Intronic
963854207 3:150237526-150237548 AAGGAGAGAAGGAGGGGGCATGG + Intergenic
963928902 3:150981361-150981383 AAGGGCTGAAAGTTGGGGGAGGG + Intergenic
963931078 3:151004873-151004895 AAAGACAGAAAGAAGAGGGAGGG - Intergenic
964525865 3:157614802-157614824 AATCCCAGAAAGAAGAGGCAAGG + Intronic
964646978 3:158968968-158968990 AAGGGAAGAAGGGAGGGGAAAGG + Intronic
964681166 3:159341150-159341172 AAGTGCAGAAAGCAAGGGGAGGG - Intronic
964714517 3:159707975-159707997 AAGGCGAGAAAGAAGTGGGAGGG - Intronic
964755124 3:160085625-160085647 AAGGCCAGAGAGCAAGGGCAGGG - Intergenic
964756103 3:160092094-160092116 AAGGTCAGACAGCAAGGGCAGGG - Intergenic
964766163 3:160179824-160179846 AAGGGCAGAAAGAGGGAGAGGGG + Intergenic
964969511 3:162542274-162542296 AAGGAAAGAAAGAAGGAACAAGG - Intergenic
965173073 3:165293857-165293879 AAGGAAAGAAAGAGGGGGGAGGG + Intergenic
965657959 3:171009493-171009515 AAGGGCAGAATTAAGGGTCGTGG + Intronic
965700958 3:171459346-171459368 AAAGTCAGAAAGAACAGGCAGGG + Intronic
965726424 3:171721303-171721325 AAGGATAGAAAGAAAGAGCAAGG + Intronic
965961979 3:174440246-174440268 GAGGGAAGGAAGAAGGGGGAAGG - Intronic
967000348 3:185327972-185327994 AAGGAAGGAAAGAAGGGGGAAGG + Intronic
967272816 3:187744749-187744771 AAGGGAAGGAAGAAGAGGCGAGG + Intronic
967317368 3:188161980-188162002 AATGGTAGAGAGCAGGGGCAGGG - Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967952238 3:194850343-194850365 AAGGGCATAAAAAAGGGGCCAGG + Intergenic
968025855 3:195442406-195442428 AGGGGCGGAAGGAAGGGGGAAGG + Intronic
968879522 4:3292153-3292175 AAGGCAGGAAGGAAGGGGCAGGG + Intergenic
968887198 4:3341287-3341309 AAGGGTAGAGAGATGGGGTATGG + Intronic
968964560 4:3763476-3763498 AAGGGCAAAAAGCTGGGGCCTGG - Intergenic
969928081 4:10603958-10603980 AGGAGCAGAAAGAAGGAGAAAGG + Intronic
970309796 4:14770020-14770042 AAGGTTAGAAAGGAGGTGCAGGG - Intergenic
970354894 4:15242231-15242253 AAGGGTAGCAAGAAGGGGTGAGG + Intergenic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
971216364 4:24665812-24665834 AAGGGCAGACAGAATGGAGAGGG + Intergenic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
972361748 4:38332041-38332063 AAGTGCAGCAAAGAGGGGCAGGG - Intergenic
972865051 4:43221744-43221766 AAGGGAAGAATGAAGGGAAATGG - Intergenic
972938804 4:44171749-44171771 AAAGGCTGAAAGAAGAGGGAAGG - Intergenic
973142331 4:46783762-46783784 AAGGGAAGAAAGAAGAAACAAGG + Intronic
973570505 4:52234184-52234206 AAGGGAAGGAGAAAGGGGCAGGG - Intergenic
973610940 4:52635520-52635542 AAGGCCAGTGAGAAGGGTCAAGG - Intronic
973786583 4:54337998-54338020 AGGGACAGAAGGAAGGGACATGG + Intergenic
973800795 4:54475787-54475809 AAGGACAGAAAGAGTGGCCAGGG + Intergenic
973886818 4:55330685-55330707 AAGGGGACAATGAAGGGGAAGGG - Intergenic
974359979 4:60865047-60865069 AAGGACAAGAAGAAGGGTCATGG - Intergenic
974385670 4:61200605-61200627 AAGAGAAGAAAGAAAGGGGAGGG - Intergenic
974524952 4:63038832-63038854 AAGAGCAGACAGGAGGGGAAGGG + Intergenic
975021531 4:69496669-69496691 AAATGCAGAAAGAAGGGGTAGGG - Intronic
975297316 4:72749542-72749564 AGAGGCAGAAAGCAGGTGCAAGG - Intergenic
975504480 4:75122995-75123017 AAGGGAAGAAGGGAGGGGAATGG + Intergenic
975597563 4:76064670-76064692 AAAGGCAGAAAGGAGGTGAAGGG + Intronic
975731771 4:77344350-77344372 TAGGCAAGAAAGAAGGGGTAAGG + Intronic
977376871 4:96216836-96216858 AAGGGCTGAAAGAAGGGAGTGGG - Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
978231565 4:106406853-106406875 AAGGGCAGAGAGAAAGGTCGGGG - Intergenic
978275984 4:106950537-106950559 ACTAGCAGAAAGAAGGGGCTTGG - Intronic
979641347 4:123015622-123015644 AAGGGGAGAAAGGCGGGGAAAGG - Intronic
979774594 4:124573357-124573379 GAGGGCAGAAAGAAGGGACGTGG + Intergenic
979851180 4:125573117-125573139 AAGGGGAGGAAAAAGGGGGAAGG - Intergenic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
980070091 4:128234727-128234749 CATGGCAGAAAGGATGGGCAAGG + Intergenic
980344587 4:131596404-131596426 AAGGGAAGAAGGAAGGGAGAGGG - Intergenic
980981792 4:139660602-139660624 GATGGCAGAGAGAATGGGCAGGG + Intergenic
981092131 4:140742846-140742868 GAGAGAAGAAAGAAGGTGCAGGG + Intronic
981572323 4:146165807-146165829 AAGGGTAGAAAGAAAGGACATGG - Intergenic
982255031 4:153443344-153443366 AAGAGAAGCAAGAAGGGGGAAGG + Intergenic
983595122 4:169457681-169457703 AAGGAGAGAAAGAAGGGGGGAGG + Intronic
984214123 4:176887259-176887281 AAAGGAAGAAAGAAAGGGAAAGG - Intergenic
984261969 4:177453367-177453389 AAGGGAGGAAGGAAGAGGCAGGG - Intergenic
984352477 4:178613312-178613334 AAGGGAAGAAAAATGGGGAATGG + Intergenic
984364799 4:178784829-178784851 ATGGGCTGTAAGAAGGGTCAAGG + Intergenic
984661412 4:182379388-182379410 AAGAGCATAAAAATGGGGCAGGG + Intronic
984846215 4:184110168-184110190 AAGAACAGAAAGAAGGGGTGAGG - Intronic
985183736 4:187294227-187294249 AAGGTCAGAATGAAGGGGGGAGG + Intergenic
985196791 4:187438904-187438926 AAGGGAAGAAGGAGGGGACAAGG + Intergenic
985307076 4:188555104-188555126 AGGGGCAGGATGAAGGGGCGCGG - Intergenic
985937232 5:3106540-3106562 AAGGGAAGAAAGGAGGGGAGGGG - Intergenic
986208357 5:5647290-5647312 GAGGGGAGGAAGAAGAGGCATGG - Intergenic
986315584 5:6584351-6584373 AAGGGGAAAAGGAAGAGGCAGGG + Intergenic
986509689 5:8491185-8491207 AAAGGCAGAAAGAAAGGACTCGG - Intergenic
986800703 5:11257213-11257235 AAGGAAAGAAAGAATGGGAAAGG + Intronic
986946669 5:13029303-13029325 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
986946681 5:13029336-13029358 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
987015608 5:13815678-13815700 AAGGGCAAAAAGAGGAGGAAGGG + Intronic
987182174 5:15379643-15379665 AAAGGCAGAAAGAAGAAGGAAGG + Intergenic
987334832 5:16889445-16889467 AAGGAAAGAAGGAAGGGGAAGGG + Intronic
987474334 5:18372282-18372304 AAGGGAAGAAAGGAGGGGATGGG + Intergenic
987782461 5:22457349-22457371 AGGAGAAGAAAGAAGAGGCAAGG - Intronic
988242594 5:28632964-28632986 AAGGGCAGAATTAAGGGAAAAGG + Intergenic
989379465 5:40798650-40798672 AAGGTTAGAAAGCAGTGGCAGGG - Intergenic
990115154 5:52380749-52380771 AAGGCCAGGAAGAAGAGGGAGGG - Intergenic
990277112 5:54209153-54209175 ATGGGCAGAATGAAGGAGTAGGG + Intronic
991167527 5:63581714-63581736 AAGAGGAGAAGGAAGGAGCAGGG + Intergenic
991986805 5:72296715-72296737 AAAGGCAGAAAGAAAGGACCAGG + Intronic
992071700 5:73154703-73154725 AAGGAAAGAAGGAAGGGGAAGGG - Intergenic
992268744 5:75044306-75044328 TGGGGCAGAAAGAAGAGGAATGG - Intergenic
992294763 5:75317025-75317047 AAAGGCAGAAAGAACTGCCAGGG - Intergenic
992332100 5:75727998-75728020 AAAGGCAGAAAGAGGGGGCAGGG + Intergenic
992530046 5:77644941-77644963 AAGGGGAGAGAGAAAGGGAAAGG - Intergenic
992629878 5:78669588-78669610 AAGGAAGGAAAGAAGGGGAAGGG + Intronic
992981218 5:82175284-82175306 AAGGGCAGAGACAAGAGGCCAGG - Intronic
993343687 5:86756051-86756073 CAGGACAGAATGAAGGGGAAGGG + Intergenic
994175872 5:96710443-96710465 AAGGGCAAGAAGAAGAGGGAAGG - Intronic
994377395 5:99030582-99030604 AAGAGGAGAAGGAAGGGGAAGGG - Intergenic
995032548 5:107495981-107496003 AAGGACAGAAAAAAGAGGCCTGG - Intronic
995083906 5:108086005-108086027 AGGGGCAGAAAAAAGGGGCAGGG - Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
995569379 5:113463259-113463281 AAGGGTTGTAAGCAGGGGCAAGG + Intronic
995767266 5:115632531-115632553 AAGGAAAGAAAGAAAGGGAAGGG + Intronic
995831524 5:116360532-116360554 AAGGGGAGAAAGAAAGAGCTGGG + Intronic
996012470 5:118496182-118496204 ACTGGCAGACAGAAGTGGCAGGG + Intergenic
996096433 5:119404080-119404102 AAGAAGAGAAAGAGGGGGCAAGG - Intergenic
996618646 5:125472502-125472524 GAGGGCAGAAATACGAGGCAAGG + Intergenic
996695761 5:126393112-126393134 AAGGGGAGAAAAAAGGGAAAAGG - Intronic
996998342 5:129726517-129726539 AAGGACTGAAAGAAGGGAGAAGG + Intronic
997713749 5:136027620-136027642 AAGGGGAGAAAGGAGAGTCAAGG - Intergenic
997719453 5:136065952-136065974 AAGGAGAGGAAGAAGGGGAATGG + Intergenic
998228486 5:140344758-140344780 AAGGGGAGGGAGAAGGTGCAGGG + Intronic
998364610 5:141621169-141621191 CAGGGAAGAAATAAGGGGCAAGG + Exonic
999296393 5:150462030-150462052 AAGGACAGATGGAAGTGGCAAGG - Intergenic
999427399 5:151499910-151499932 CAGGCCAGAAGGGAGGGGCAGGG - Intergenic
1000185059 5:158851357-158851379 AAGGGAAGAAGGAAAGGGAAGGG + Intronic
1000611288 5:163378117-163378139 GCGGGCAGAAAGAAGGCACAGGG + Intergenic
1001071648 5:168590514-168590536 AAGGCAGGAAAGAAGGGGCCAGG + Intergenic
1001084436 5:168690550-168690572 CAGGGAAGAATGAAGGGGCAAGG - Intronic
1001084734 5:168692313-168692335 GAGGCAAGGAAGAAGGGGCAGGG + Intronic
1001265149 5:170268649-170268671 TAGGACAGAAAAAATGGGCAGGG - Intronic
1001298517 5:170516391-170516413 AAGGGAAGAAAGAAAGGTCCAGG - Intronic
1001335833 5:170795803-170795825 AAGGGAAGAAATAAGGGCAATGG + Intronic
1002046793 5:176545999-176546021 AAGGGCAGGGAGAGGGGGCAGGG + Intronic
1002152320 5:177244643-177244665 AGTGGAAGAAAGAAGTGGCATGG - Intronic
1002331192 5:178442115-178442137 AAGAGGAGAAAGCAGGGGCCAGG - Intronic
1002531981 5:179852669-179852691 AAGGTCAGAAAGAAAGCACATGG + Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1002663302 5:180805132-180805154 AAGGATAGAAACAAGGGGCCAGG + Intronic
1002701288 5:181127065-181127087 AACGGCAGCAGGAAGGGGCCTGG - Intergenic
1002775479 6:324544-324566 CAGGGCAGAAAGAACGTCCACGG - Intronic
1003487841 6:6595197-6595219 AGGGGGAGAAAGAAGAGGAAGGG + Intronic
1004581969 6:16963151-16963173 AAGGACAGAAAGAAGGCCTAGGG - Intergenic
1004609194 6:17223004-17223026 AAAGGCAAAAAGGAGGTGCAGGG - Intergenic
1004664029 6:17735107-17735129 AAGGGGGGAAAGACGGGGAAAGG - Intergenic
1004899674 6:20182656-20182678 GGGGGCAGGAGGAAGGGGCAAGG - Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005321226 6:24656383-24656405 AAGGGAGGAAAGAAGAGACAGGG + Intronic
1005369087 6:25111527-25111549 AAGGTCAGACAGAAGGGTCGGGG + Intergenic
1005390428 6:25327257-25327279 AAGAACAGAAAGAACGGCCAGGG + Intronic
1006166923 6:32070645-32070667 AAGGGGAGTAAGATGAGGCAGGG - Intronic
1006167483 6:32073570-32073592 CAGGGCTGGAAGAAGGGCCATGG + Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006503430 6:34472856-34472878 AGGGGCACAAAGGAGGGGCCGGG + Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006801058 6:36759847-36759869 ATGGGCAGAGGGAAGGGGCAGGG + Intronic
1006827784 6:36948768-36948790 AAGGAAAGAAAGAAAGGGAAGGG - Intronic
1006881408 6:37343198-37343220 AAGGGAAGAGAGAATGGGGAAGG - Intergenic
1006978697 6:38127904-38127926 CAGGGCAGGAAGAAGTGACAGGG - Intronic
1007413522 6:41678828-41678850 AAGGGGAGAGGGAAGGCGCATGG - Intergenic
1007610766 6:43147391-43147413 GAGGGAAGGAAGAAGGGGCCGGG - Intronic
1007616212 6:43181054-43181076 AAGAGCAGAGAAAAGGGGCTGGG - Exonic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1007961388 6:45963015-45963037 AGGAGTAGAAAGAAGGGGCTGGG - Intronic
1008913077 6:56757681-56757703 GAGGGAAGGAAGAAGGGGCAAGG - Intronic
1009039827 6:58162714-58162736 AAGGACAGAAACAGAGGGCATGG + Intergenic
1009215722 6:60917561-60917583 AAGGACAGAAACAGAGGGCATGG + Intergenic
1009394725 6:63186378-63186400 AAGTGCAGAGTAAAGGGGCAGGG - Intergenic
1009596103 6:65738852-65738874 CAGAGCAGGAAGATGGGGCAAGG - Intergenic
1009681137 6:66894953-66894975 AAGGCCAGAAAGGAAGGGAAGGG - Intergenic
1011335930 6:86259688-86259710 AGGAGAAGAAAGAAGGGTCAGGG + Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012355574 6:98310003-98310025 AAGGTCTGAGATAAGGGGCAAGG - Intergenic
1012540167 6:100353489-100353511 AAGGCCACAAAGGAGTGGCAGGG + Intergenic
1013068983 6:106711188-106711210 ATGGGAAAGAAGAAGGGGCAGGG - Intergenic
1013457277 6:110342008-110342030 AAGGTGAGAAAGAAGGGCCAAGG + Intronic
1013720505 6:113020955-113020977 AAGGGCAGAAAAAAGGTGGAAGG + Intergenic
1014777119 6:125523995-125524017 AAGGGCAGAGAGATGAGGGAGGG - Intergenic
1015112461 6:129609066-129609088 AAGAGGAGAGAGAGGGGGCATGG + Intronic
1015211947 6:130708618-130708640 AGAGGAAGGAAGAAGGGGCAGGG + Intergenic
1015238935 6:131002351-131002373 GAGAGAAGAAAGAAGGGGAATGG + Intronic
1016261985 6:142182887-142182909 AAGTGTAGAAAGAAGAGACAAGG + Intronic
1017134979 6:151140122-151140144 AAGGGCAGAAACAAGAGGTTTGG + Intergenic
1017166700 6:151414861-151414883 GAGGTCAGAAGGAAGTGGCATGG + Intronic
1017634763 6:156432720-156432742 AAAGGCAGGAAGAAAGGGAAGGG + Intergenic
1017930012 6:158943835-158943857 GAGGGAAGAAAGAAAGGGAAGGG - Intergenic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018345176 6:162892422-162892444 ATGACCAGAATGAAGGGGCAAGG + Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1019178610 6:170173796-170173818 AGGGAGAGGAAGAAGGGGCAGGG + Intergenic
1019500175 7:1360728-1360750 AAGGGCAGAGAGCTGGGGCCAGG + Intergenic
1019829083 7:3308210-3308232 CATGGCTGGAAGAAGGGGCAAGG + Intronic
1019877878 7:3831071-3831093 GAGGGCACAAACAAGGGGGATGG + Intronic
1020087155 7:5316702-5316724 AAGGACACAAAGAATGGGAAAGG + Intronic
1020129043 7:5549150-5549172 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1020581352 7:10006772-10006794 AAAGGAACAAAGAAGGGGAAAGG - Intergenic
1021408807 7:20304840-20304862 AATGGGAGAATGAAGGAGCAGGG - Intergenic
1021602315 7:22376594-22376616 ATGGGCTGAAAGTAGGGGCCAGG + Intergenic
1021950511 7:25769569-25769591 GAGGGAGGAAAGAAGGGGAAGGG + Intergenic
1022440465 7:30428823-30428845 GAGGCAAGAAAGAAGTGGCATGG + Intronic
1022820610 7:33956542-33956564 AAGGGGAGACAGGAGAGGCAGGG - Intronic
1023083976 7:36551547-36551569 AAGGGCAGAAAGTAGGAGGGTGG - Intronic
1023559385 7:41458080-41458102 AAGGGAAGAAAGGAAGGGAAGGG - Intergenic
1024142731 7:46478667-46478689 AAGGGGAGAGAGGAAGGGCAGGG + Intergenic
1024355634 7:48411137-48411159 AAGGGGAGAAAGAAAAGGAAAGG - Intronic
1024654154 7:51434906-51434928 AAGGGGAGAGTGAGGGGGCATGG - Intergenic
1024733465 7:52277502-52277524 AAGGACAGAAAGCAAGGACAAGG + Intergenic
1024933619 7:54690251-54690273 GAGGGCAGAAGGCAGGGCCAGGG - Intergenic
1024970855 7:55068860-55068882 ATGTGTAGAAAGAAGGGTCAGGG + Intronic
1025250437 7:57347973-57347995 AACGGCAGGAAGAAGGGTCAAGG + Intergenic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1026040642 7:66865603-66865625 AAGGGGAAAAGGAAGGGGAAGGG - Intergenic
1026040694 7:66865776-66865798 AGGGGCAAAAGGAAGGGGAAGGG - Intergenic
1026218374 7:68369704-68369726 AGAGAAAGAAAGAAGGGGCATGG + Intergenic
1026243282 7:68595881-68595903 AGGAGCAGAAAGTAGGGGAAAGG - Intergenic
1026416233 7:70183631-70183653 ATGGGCAGAAGGAAGAGGAAAGG - Intronic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026871034 7:73852030-73852052 AAGGGAAGGAGGAAGGGGGAAGG - Intergenic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027198462 7:76047694-76047716 AAGGGCAGAAGGAATGGGTTTGG + Exonic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1028153002 7:87396618-87396640 AAGAGATGAAAGAAGAGGCAGGG - Intronic
1028536448 7:91893009-91893031 GGGGGCAGAAAGAAGTGGGAGGG - Intergenic
1028899381 7:96079936-96079958 AAAGGCAGAAAGCAGGTGTATGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029578771 7:101421032-101421054 GAGGGCACAAAGGAGGGGAAGGG - Intronic
1029654741 7:101916864-101916886 AAGGGAAGGAAGAAGGGGCCAGG - Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1033301319 7:140188696-140188718 AAGGAAAGAAAGAAAGGGGAAGG + Intergenic
1033601570 7:142892451-142892473 AGGGGCAGAAAAAAGAGGCTTGG - Intergenic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1033790791 7:144790570-144790592 CAGAGCAGGAAGAAGTGGCAGGG + Intronic
1033817039 7:145085488-145085510 AAGGGCAGGAAGAAGAGGGCAGG + Intergenic
1034149570 7:148903677-148903699 CAAGGCAGAAAGAAGGGGAAGGG + Intergenic
1034271797 7:149806683-149806705 AAGGGCAGGAAGGACGGGAAGGG - Intergenic
1034448014 7:151123216-151123238 GAGGCCAAAAAGAGGGGGCAAGG - Intronic
1034757556 7:153637091-153637113 AAAGAAAGAAATAAGGGGCAGGG - Intergenic
1035024149 7:155815398-155815420 AGGGGCCGGAAGGAGGGGCAGGG - Intergenic
1035756887 8:2041355-2041377 AAAGGCAGAAAAAAGGAACAAGG + Intergenic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036224396 8:6945460-6945482 AAGGGCTGAGGGGAGGGGCAGGG - Intergenic
1036493804 8:9251478-9251500 GATGGGAGAAAGAAGGGGCTGGG - Intergenic
1036606701 8:10312168-10312190 AAGGGCAGAAAGAAATGAAATGG + Intronic
1037454108 8:19046585-19046607 AAAGGCAGAAAGAAATGGTAAGG - Intronic
1037816332 8:22114668-22114690 AAGGGCAGACAGGCGGGGCAAGG + Exonic
1037878507 8:22561281-22561303 CGGGGCAGAAAGCAAGGGCAGGG - Intronic
1037918653 8:22788305-22788327 AGGGGGACAAAGAAGGAGCAGGG + Intronic
1038030514 8:23634541-23634563 AAGGGAAGAAAGGAAGGGGAGGG - Intergenic
1038166527 8:25090248-25090270 AAGGGAAAAAAGATGGGGCTTGG + Intergenic
1038486519 8:27939237-27939259 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1038625406 8:29187963-29187985 AAGGGCAGAAAGCTGGGGCCAGG - Intronic
1038754460 8:30327739-30327761 AAGGACAAAAAGAGAGGGCAAGG + Intergenic
1038963682 8:32548760-32548782 AAGGGCAAGAAGAAGGAGCGAGG + Exonic
1039212568 8:35234531-35234553 AAAGGCAAAAAAAAGGGGGATGG - Intergenic
1039216934 8:35282402-35282424 AAGGGTATTAAGAAGGGTCATGG - Intronic
1039221794 8:35339847-35339869 AAGGGCAGTAGGAAGAGGAAGGG + Intronic
1039535744 8:38310805-38310827 AAGAACTGAAAGAAGGGGCCAGG - Intronic
1039955089 8:42201170-42201192 AATGCCACAAAGAAGGGGCGTGG + Intronic
1040539815 8:48342430-48342452 ATGAGCAGAGAGAAGGGACAGGG + Intergenic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040879337 8:52188650-52188672 AAGGTTAGAAACAAGGAGCATGG + Intronic
1041584937 8:59505382-59505404 AAGGGAGGAAGGAGGGGGCAAGG + Intergenic
1041787054 8:61646977-61646999 AGCGGCCGAAAGGAGGGGCAGGG - Intronic
1041905848 8:63032502-63032524 AGGGGCAGAAAGAAGGCAGAAGG + Intronic
1041982778 8:63882099-63882121 AAAGGTAGAAAGGAAGGGCAAGG + Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042059212 8:64798873-64798895 CCGGGCAGGAAGAAGGGCCAAGG + Intergenic
1042467551 8:69145108-69145130 AAGGAGAGAAAGAAGGGGAGTGG + Intergenic
1042664306 8:71189494-71189516 AACGGAAGAAGGAAGGGGCCAGG - Intergenic
1042973294 8:74434662-74434684 GACGGCTGAAGGAAGGGGCATGG - Intronic
1043544433 8:81299625-81299647 AAGGGAGGGAAGAGGGGGCAAGG - Intergenic
1044002415 8:86899957-86899979 ATGGGCAGAGAGGAGGGGTAGGG - Intronic
1044092332 8:88017307-88017329 AAAGGCAGGAAGTAGGGGCAGGG + Intergenic
1044346090 8:91106012-91106034 TAAAGCAGAGAGAAGGGGCAGGG + Intronic
1044459147 8:92424937-92424959 AAGGGCATAAATGAGAGGCAGGG + Intergenic
1044503920 8:92993991-92994013 AAGGGCAGAAAGAACCAGAAAGG + Intronic
1044611894 8:94099696-94099718 AAGAGCAGAATCAAGGGGGAAGG + Intergenic
1044714136 8:95085330-95085352 AAGTGTAGAATGAAGAGGCATGG - Intronic
1044751090 8:95416029-95416051 AAGAGAAGAAAGAAGGGGGTGGG - Intergenic
1045265350 8:100614159-100614181 AGAGACAGAAAGAAGGGGAAGGG - Intronic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1045646530 8:104305093-104305115 AAGGGAAGAATGAAGGGAAAGGG - Intergenic
1045706702 8:104931669-104931691 AAAGGCAGAAGGAAGGGGCCAGG + Intronic
1045814002 8:106258299-106258321 AAGGGCAGAAGGATAGAGCAAGG - Intergenic
1046048127 8:108987382-108987404 AAGGGCAGAAAAGAGAGGTAGGG + Intergenic
1046236307 8:111428100-111428122 AAGGAAGGAAAGAAGGAGCAAGG - Intergenic
1046555561 8:115768716-115768738 AAGGGAAGAAAGGATGGGAAGGG - Intronic
1046571266 8:115969196-115969218 AAGGAAGGAAAGAAGGGGGAAGG - Intergenic
1046725454 8:117668909-117668931 AAAGACAGAACGAAGGGGAAGGG - Intergenic
1047098673 8:121652242-121652264 AAGTGGAGAAAAAAGAGGCATGG - Intergenic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047153975 8:122296346-122296368 AAGGGGATAAAGAAAGGGAAGGG + Intergenic
1047886081 8:129251458-129251480 AAGGCCAGAGAAAAAGGGCATGG - Intergenic
1048234935 8:132680699-132680721 AAGGGAAGAGAGGAGGGGAAAGG - Intergenic
1048308912 8:133303276-133303298 AGGGGCAGGAAGAAGGGGAACGG - Intergenic
1048588913 8:135802929-135802951 AAGGGCAAGAGGAAGGGGAAGGG - Intergenic
1048837886 8:138538375-138538397 AAGGGAAGAAAGGAAGGGAAGGG + Intergenic
1049146658 8:141005603-141005625 AAGAGCAGAAGTCAGGGGCAGGG + Intergenic
1049204303 8:141356333-141356355 AAGGACAGAAAGAAAAGGCCAGG - Intergenic
1049567513 8:143348735-143348757 AAGGGCCAAATGGAGGGGCATGG + Intronic
1049725146 8:144142330-144142352 GAGGGCTGAAAGCAGGGGCCTGG + Intergenic
1050041342 9:1496951-1496973 AAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1050165017 9:2756401-2756423 AAGGGAAAAAAGAGGGGACAGGG + Intronic
1050636640 9:7619529-7619551 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1050847985 9:10247736-10247758 GAGGAGAGAAAGAAGTGGCAAGG + Intronic
1051086194 9:13351397-13351419 AAGGTCAGAGAGAAGGGACTTGG + Intergenic
1051160833 9:14205241-14205263 AAGGGAGGAAGGAAGGGGGAGGG + Intronic
1051449628 9:17180868-17180890 AAAACCAGAAGGAAGGGGCATGG - Intronic
1051487073 9:17620562-17620584 AAGGGCAGACAGAAGAGGGTTGG + Intronic
1051603345 9:18896417-18896439 AAGTGCAGAAAGAGGGGGAGGGG + Intronic
1052103682 9:24483830-24483852 AGAGGCAGAAAGAAGGGGGGTGG - Intergenic
1052140318 9:24973701-24973723 AAGGGCAGAAGCATGGGGCAGGG + Intergenic
1052173331 9:25427810-25427832 AATGGCAGGTAGAAGGGGAAGGG - Intergenic
1052178793 9:25500108-25500130 TAAGGCAGAAAAAATGGGCATGG - Intergenic
1052849205 9:33366089-33366111 AAGGGAGGAAAGGAGGGGAATGG - Intronic
1052909110 9:33864196-33864218 AAGGGCAGAAAAAAACGGAAAGG + Intronic
1053147992 9:35724964-35724986 TAGGGCAGGAAGAAGAGACAGGG + Intronic
1053186901 9:36023856-36023878 GAGGGCTGAAGGAAGAGGCAGGG + Intergenic
1053197185 9:36128303-36128325 AAGGGGGACAAGAAGGGGCATGG - Intergenic
1053742781 9:41158038-41158060 CAGGTCACAAACAAGGGGCACGG + Intronic
1054348058 9:63987879-63987901 CAGGTCACAAACAAGGGGCACGG + Intergenic
1054445787 9:65314224-65314246 CAGGTCACAAACAAGGGGCACGG + Intergenic
1054484482 9:65707281-65707303 CAGGTCACAAACAAGGGGCACGG - Intronic
1054685560 9:68273260-68273282 CAGGTCACAAACAAGGGGCATGG - Intronic
1054810848 9:69432753-69432775 AAGAGCAGAGTGTAGGGGCAGGG - Intronic
1054972568 9:71105626-71105648 AGGGCCAGATAGAAGAGGCATGG + Intronic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1055244264 9:74220831-74220853 AAGGCCATCAAGTAGGGGCAGGG - Intergenic
1055718848 9:79148856-79148878 AAGGGAAGAAAGTAGGGGGTGGG - Intergenic
1056572387 9:87826988-87827010 AAAGGAAGAAAGAAAGGGAAAGG + Intergenic
1057403739 9:94748137-94748159 AGGTGCAGAAAGAATGGGCAGGG - Intronic
1058324648 9:103680295-103680317 AAGGGAAGAAGGAAAGGGAAGGG + Intergenic
1059309934 9:113381353-113381375 AAGGAAAGAAAGAAAGGGAAGGG - Intergenic
1059825792 9:118027509-118027531 CAGGGCAGAAGGAAGGGGCGGGG - Intergenic
1059995236 9:119902727-119902749 GGGAGCAGAAAGAAGGAGCAGGG - Intergenic
1060160594 9:121359181-121359203 AATGGCAGTAAGATGGGGCTTGG + Intronic
1060243396 9:121924375-121924397 GAGGGCAGAGAAAAGAGGCAAGG + Intronic
1060664079 9:125422579-125422601 AAGGGAAGAAAAAATGGACAAGG + Intergenic
1060743446 9:126114365-126114387 AAGGAAGAAAAGAAGGGGCAGGG - Intergenic
1060833512 9:126736133-126736155 AATAGCACAAAGAAGGGGAAGGG + Intergenic
1061250142 9:129421737-129421759 CAGGGCAGGAATAAGAGGCAGGG - Intergenic
1061289191 9:129641292-129641314 GAGAGCAGAAGGAAGGGGCTCGG - Intronic
1061414025 9:130436232-130436254 AAGGGAAGACAGAAAGGTCAAGG + Intergenic
1061498236 9:130987859-130987881 CTGGGCAGAAAAAAGAGGCAGGG + Intergenic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061930791 9:133832116-133832138 GAGGACAGGAAGAAGGTGCAGGG + Intronic
1062013107 9:134277438-134277460 AAGGGGAGAAGACAGGGGCATGG - Intergenic
1062098035 9:134712660-134712682 GAGGGCAGAAGGAAGGGGTAAGG - Intronic
1062169086 9:135124545-135124567 AAGGAAGGAAGGAAGGGGCAGGG + Intergenic
1062209064 9:135353416-135353438 AAGGGAAGACAGACGGGGCCAGG + Intergenic
1203443137 Un_GL000219v1:30032-30054 CAGGCAAGAAAGAAGGGTCACGG - Intergenic
1203513945 Un_KI270741v1:148941-148963 CAGGCAAGAAAGAAGGGTCACGG - Intergenic
1185533102 X:837738-837760 TAGAGCAGGAAGCAGGGGCAGGG + Intergenic
1185701230 X:2231948-2231970 AAGGGCAGAAAGAAAAGAGAAGG - Intronic
1185825043 X:3241836-3241858 AAGGACAGTACGAAGGGGAATGG + Intergenic
1185862523 X:3592438-3592460 AAGGGCAAGAAGAAGAGGGAGGG + Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186588098 X:10898138-10898160 AAGGGAAGGAGGAAGGGGAAAGG + Intergenic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186771755 X:12825319-12825341 AGGGGCAGAAAAAAGGTGGAGGG - Intergenic
1186809168 X:13170258-13170280 AAGGAAAGAAAGAATGGGCATGG - Intergenic
1187064207 X:15817030-15817052 AAAGGCAGGAAGAAGTGACAAGG - Intronic
1187452530 X:19411588-19411610 AAGGGCATTAAGATAGGGCAGGG + Intronic
1187496991 X:19803831-19803853 CAGGTTAGAAAGAAGGGCCAGGG - Intronic
1187783543 X:22857351-22857373 AAGGGGAGAAAAGAGGGGGAGGG - Intergenic
1188013928 X:25086861-25086883 AAGGGCATAGAGTAGGGGCCAGG + Intergenic
1188361590 X:29261532-29261554 AACGGCAAAAAGCAGGGGTAAGG - Intronic
1188981860 X:36733883-36733905 AAGGGCAGGCAGAATGTGCATGG - Intergenic
1189110548 X:38285942-38285964 AAGGGGAGGAAGAAGAGGAAGGG - Exonic
1189177186 X:38969578-38969600 AGGGGCAGCAGGAAGGGGCTAGG - Intergenic
1189197128 X:39162170-39162192 TAGGGCAGAAAGGATGGGAAAGG - Intergenic
1189387451 X:40549067-40549089 GAGGGCAGAAAGTAGTGGCTTGG - Intergenic
1189431733 X:40953046-40953068 GTAGGCAGGAAGAAGGGGCAAGG - Intergenic
1189463457 X:41260747-41260769 AAGGCCAAGAAGATGGGGCATGG - Intergenic
1189877746 X:45454440-45454462 AAGGACAGATAGAAGAAGCAGGG + Intergenic
1189915385 X:45851226-45851248 AGGGGCAGAAGGAAGGTGCACGG - Intergenic
1189953510 X:46256021-46256043 CAGGGCAGCAAGAAGGGACTGGG + Intergenic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1190445430 X:50519320-50519342 AAAGGGAGAAGGAAGGGGTAAGG - Intergenic
1190446302 X:50528272-50528294 CAAGCCAGAAAGTAGGGGCATGG - Intergenic
1190874680 X:54451234-54451256 CAGGGCAGACAGAAGAGTCAGGG - Intronic
1191026056 X:55914674-55914696 AAGTTGAGAAAGAAGGAGCATGG + Intergenic
1191766904 X:64707590-64707612 AAGGCCAGAAAGCAAGGGAAGGG + Intergenic
1192191024 X:68991209-68991231 AAGGGAAGAAGGAAGAGGGAAGG - Intergenic
1192231378 X:69267468-69267490 GAGGGCAGCAAGGAAGGGCAAGG + Intergenic
1192315209 X:70045852-70045874 GAGGGCAGCAAGCAGGGCCAGGG + Intronic
1194010904 X:88559752-88559774 AAGGGAAGAATGAAGGGAAAAGG - Intergenic
1194584690 X:95717901-95717923 AAGGGCAGGCAGGAGGGGAAGGG + Intergenic
1194734348 X:97494599-97494621 AAGTCCAGAAAGAATGGGAAGGG - Intronic
1195110106 X:101639786-101639808 AAGGGCAGAGAGCAGGGAGATGG + Intergenic
1195246777 X:103002193-103002215 AAGGAAATAAAGATGGGGCAGGG - Intergenic
1195655532 X:107328212-107328234 CAGGGCAGGAAGCATGGGCAAGG + Intergenic
1195662261 X:107391303-107391325 AGGGGCAGAGAGAGGGGGTAAGG - Intergenic
1195804087 X:108743147-108743169 AAGGGCAGAAGGAAGAAGGAAGG + Intergenic
1195966378 X:110433475-110433497 AAGGGCAGGGAGATGGGGGAAGG + Intronic
1197263512 X:124341667-124341689 AAGGGAAAAAAGAGGGGGAAAGG + Intronic
1197723588 X:129761095-129761117 TAGTGAAGCAAGAAGGGGCAAGG + Intronic
1197776072 X:130119504-130119526 GGGGACAGAAAGAGGGGGCAGGG + Intergenic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1198618101 X:138480350-138480372 CAGGGCTGACTGAAGGGGCAGGG - Intergenic
1198999692 X:142620153-142620175 AAAGGGAGAGAGAAGGGGAAAGG + Intergenic
1199432437 X:147776559-147776581 AAGGGAAGCTAGAAGGGGGATGG + Intergenic
1199628549 X:149761151-149761173 CATGGCTGACAGAAGGGGCAGGG - Intergenic
1199966286 X:152823686-152823708 AAGGGGAGGAAGAGGGAGCAGGG - Intergenic
1200109008 X:153729576-153729598 AAAGGCAACAAGGAGGGGCAAGG - Intronic
1201458965 Y:14201478-14201500 AAGGAGAGAAAGAAGGGGCTGGG + Intergenic