ID: 1061539770

View in Genome Browser
Species Human (GRCh38)
Location 9:131271839-131271861
Sequence AGTTGAGGAATTGCGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061539764_1061539770 -7 Left 1061539764 9:131271823-131271845 CCAGCTGACAGGTGGCAGTTGAG 0: 1
1: 0
2: 0
3: 9
4: 199
Right 1061539770 9:131271839-131271861 AGTTGAGGAATTGCGGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061539770 Original CRISPR AGTTGAGGAATTGCGGGGGC CGG Intronic
No off target data available for this crispr