ID: 1061540904

View in Genome Browser
Species Human (GRCh38)
Location 9:131277479-131277501
Sequence CGGGCGCGCTCGCCGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061540888_1061540904 16 Left 1061540888 9:131277440-131277462 CCCCTCTCCAGCCGCGAGCAGCC No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540893_1061540904 9 Left 1061540893 9:131277447-131277469 CCAGCCGCGAGCAGCCCCGGGTC No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540899_1061540904 -7 Left 1061540899 9:131277463-131277485 CCGGGTCCCCACGCGTCGGGCGC No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540898_1061540904 -6 Left 1061540898 9:131277462-131277484 CCCGGGTCCCCACGCGTCGGGCG No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540887_1061540904 25 Left 1061540887 9:131277431-131277453 CCTCTGTCGCCCCTCTCCAGCCG No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540889_1061540904 15 Left 1061540889 9:131277441-131277463 CCCTCTCCAGCCGCGAGCAGCCC No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540894_1061540904 5 Left 1061540894 9:131277451-131277473 CCGCGAGCAGCCCCGGGTCCCCA No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540890_1061540904 14 Left 1061540890 9:131277442-131277464 CCTCTCCAGCCGCGAGCAGCCCC No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data
1061540897_1061540904 -5 Left 1061540897 9:131277461-131277483 CCCCGGGTCCCCACGCGTCGGGC No data
Right 1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061540904 Original CRISPR CGGGCGCGCTCGCCGCTGCC GGG Intergenic
No off target data available for this crispr