ID: 1061542043

View in Genome Browser
Species Human (GRCh38)
Location 9:131282823-131282845
Sequence ACAGTCTCCCAGCCCAGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061542039_1061542043 2 Left 1061542039 9:131282798-131282820 CCGCCCGGGGCGCGCGTCAGAAC No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542041_1061542043 -2 Left 1061542041 9:131282802-131282824 CCGGGGCGCGCGTCAGAACGCAC No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542030_1061542043 27 Left 1061542030 9:131282773-131282795 CCGCCCTGAGCGCCTAAGGTCTT No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542031_1061542043 24 Left 1061542031 9:131282776-131282798 CCCTGAGCGCCTAAGGTCTTCCC No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542035_1061542043 15 Left 1061542035 9:131282785-131282807 CCTAAGGTCTTCCCCGCCCGGGG No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542040_1061542043 -1 Left 1061542040 9:131282801-131282823 CCCGGGGCGCGCGTCAGAACGCA No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542032_1061542043 23 Left 1061542032 9:131282777-131282799 CCTGAGCGCCTAAGGTCTTCCCC No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542029_1061542043 30 Left 1061542029 9:131282770-131282792 CCACCGCCCTGAGCGCCTAAGGT No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542038_1061542043 3 Left 1061542038 9:131282797-131282819 CCCGCCCGGGGCGCGCGTCAGAA No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data
1061542037_1061542043 4 Left 1061542037 9:131282796-131282818 CCCCGCCCGGGGCGCGCGTCAGA No data
Right 1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061542043 Original CRISPR ACAGTCTCCCAGCCCAGGTC CGG Intergenic
No off target data available for this crispr