ID: 1061543492

View in Genome Browser
Species Human (GRCh38)
Location 9:131290588-131290610
Sequence CCGGAGCCTGCCTGTTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061543492_1061543502 -1 Left 1061543492 9:131290588-131290610 CCCCAGAAACAGGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1061543502 9:131290610-131290632 GCGTGGGGGAGCGACAGCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 162
1061543492_1061543503 13 Left 1061543492 9:131290588-131290610 CCCCAGAAACAGGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1061543503 9:131290624-131290646 CAGCCAGGGATGCATAGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 118
1061543492_1061543501 -2 Left 1061543492 9:131290588-131290610 CCCCAGAAACAGGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1061543501 9:131290609-131290631 GGCGTGGGGGAGCGACAGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061543492 Original CRISPR CCGGAGCCTGCCTGTTTCTG GGG (reversed) Intronic
900297200 1:1957748-1957770 CCGGAGCCTGGCTGTCTGCGGGG + Intronic
900329500 1:2126941-2126963 CCGGGTTCTGCCTGTTCCTGGGG + Intronic
901137619 1:7008032-7008054 CCCCAGCCTGCGTGTTTCTCTGG + Intronic
901137818 1:7009173-7009195 TCCGAGCCTGCCTTGTTCTGAGG - Intronic
901634694 1:10665083-10665105 CTGAAGCCTGCCTGGTGCTGGGG + Exonic
902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG + Intergenic
905230787 1:36513938-36513960 CAGGACCCTTCCTGTTTCTAAGG + Intergenic
906136924 1:43506395-43506417 CTGGAGCCTGTCTGACTCTGTGG + Intergenic
906668060 1:47635593-47635615 CCTGAACCTGGCTGTTTCTGGGG + Intergenic
907544816 1:55250476-55250498 GCAGAGCCTGCCTCTTTCTCTGG - Intergenic
908298356 1:62736151-62736173 CTGGATCCTGCCTATTTTTGTGG + Intergenic
915097637 1:153474751-153474773 CAGGAGCCTGCCTGGCCCTGGGG + Intergenic
916574746 1:166057337-166057359 CCAGAGCTTGCTTGTTCCTGGGG + Intergenic
917978534 1:180255199-180255221 ACTGAGGCTGCCTCTTTCTGGGG - Intronic
921325310 1:213982728-213982750 CCGCCGCCCGCCTGTTGCTGTGG - Intergenic
922165773 1:223114639-223114661 CCACAGCCTCCCAGTTTCTGTGG - Intronic
1064753109 10:18552389-18552411 CCTGAGTCTCCTTGTTTCTGTGG + Intronic
1067213179 10:44278859-44278881 CTGGAGCCTGTGTGTTGCTGGGG + Intergenic
1067700869 10:48570949-48570971 CCAGAGCATGCCTGCTTCTTTGG + Intronic
1069633363 10:69911056-69911078 CCAGGGCATTCCTGTTTCTGGGG - Intronic
1070957493 10:80474011-80474033 CCTGGGCCTGCCTGTTCCTTTGG + Intronic
1071268293 10:83983801-83983823 CCTGAGCTTGCCAGGTTCTGTGG - Intergenic
1074855068 10:117467331-117467353 CCAGAGGCTGCCTGTGTCCGTGG + Intergenic
1076800640 10:132826474-132826496 CCGGCTCCTGCCTGGCTCTGTGG - Intronic
1077574413 11:3370645-3370667 CCTGTACCTGCCTGTTTTTGAGG - Intronic
1083225608 11:61282630-61282652 TCAGAGCCTGCCTGTCCCTGGGG - Intronic
1083329383 11:61890587-61890609 CAGGGGCCAGCCTGTTCCTGGGG + Intronic
1087755030 11:102046537-102046559 CCGCACCCGGCCTGTTTCTATGG - Intergenic
1088420109 11:109636066-109636088 TGGGAGCCAGTCTGTTTCTGGGG + Intergenic
1088821444 11:113460797-113460819 CTGGAGCCTCCCAGTTTCTCTGG - Intronic
1089330595 11:117686398-117686420 CCAGTGCCTGCTTCTTTCTGAGG - Intronic
1089386774 11:118073672-118073694 CGGGTGCCTGCCTGTCCCTGGGG + Intergenic
1090788476 11:130070003-130070025 CAGGAGCCTGCCCGTGGCTGCGG - Exonic
1090841203 11:130488709-130488731 CAGCAGCCTCCCTGATTCTGTGG + Intergenic
1091860353 12:3776032-3776054 CTAGAGCCAGCCTGTCTCTGTGG - Intergenic
1094358208 12:29601192-29601214 CCGGAGCTGGCATGATTCTGGGG + Intronic
1096202057 12:49691500-49691522 ACATAGCCTGCCTGTATCTGGGG + Intronic
1101407190 12:104438994-104439016 AGGGAGACTGCCTTTTTCTGGGG - Intergenic
1101589121 12:106110831-106110853 GCAGTGCCTGCCTGTTTCAGAGG + Intronic
1102552011 12:113698230-113698252 CCTGAGCCTGCGTGTTTCCTGGG - Intergenic
1103000653 12:117383187-117383209 CCTGAGCCTGCCCTTTTGTGGGG + Intronic
1103597850 12:122035052-122035074 AATAAGCCTGCCTGTTTCTGGGG - Intronic
1104042245 12:125138211-125138233 CCGGCGCCTGCCCGCATCTGCGG + Intronic
1106759247 13:32851451-32851473 CTGGAGCTTTCCTGTGTCTGGGG + Intergenic
1108359023 13:49652592-49652614 CAAGAGCCTGCCTGCTGCTGGGG + Intergenic
1108710252 13:53026402-53026424 CAGGAGGCTGCTTGTTTCTTAGG + Intergenic
1110014703 13:70386485-70386507 TCTGAGCCTGACTGATTCTGGGG + Intergenic
1115019219 14:28654760-28654782 CAGGAGCCTGACTGTGACTGAGG + Intergenic
1118322353 14:64760559-64760581 CTGCAGTCAGCCTGTTTCTGGGG - Intronic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1119476858 14:74935324-74935346 CCGGACCCTTCCTTTTCCTGAGG - Intergenic
1121437897 14:93930902-93930924 CCAGGCCATGCCTGTTTCTGTGG - Intergenic
1122114777 14:99522227-99522249 CCGGAGCCTGCCTGCTGCAGGGG + Exonic
1122790668 14:104182954-104182976 CCAGAGCCTGCTTCTTGCTGGGG + Intergenic
1122941087 14:104981721-104981743 CCGCAGCCTGCCTGTTTGTGGGG - Intergenic
1127474433 15:59319612-59319634 CCCGTGCCTGGCTGTCTCTGGGG - Intronic
1128311502 15:66633972-66633994 CCTGAGCCTGCCTGTCTGTGAGG - Intronic
1130300915 15:82679626-82679648 CTGGTGCCTGCCTATTCCTGGGG - Intronic
1132115373 15:99131854-99131876 CCGGAGCCAGCCGGTCTGTGAGG + Exonic
1133293905 16:4740671-4740693 CCCGTGCCTGGCTGTTTCTCAGG + Intronic
1133916596 16:10114540-10114562 CCGGTGCCTGCGGGTTTCTGGGG - Intronic
1134344395 16:13376340-13376362 CTGGAGCCTGACTGATTCTCTGG + Intergenic
1135552084 16:23406195-23406217 CCGGAGCCTGGCTGGTTTTCAGG - Exonic
1135804366 16:25528798-25528820 CTGGAGGCTGCCAGTTTCTCTGG - Intergenic
1137299897 16:47138820-47138842 CTGGAGCCTGCGTGTCTCTCTGG + Intronic
1138615881 16:58166055-58166077 ATGGAACCTCCCTGTTTCTGAGG - Intronic
1140670656 16:77275142-77275164 AAGGAGCAAGCCTGTTTCTGTGG - Intronic
1140972839 16:80029893-80029915 CAGGAGACTGCCTGTTTCTTGGG - Intergenic
1141139596 16:81488675-81488697 CAGGAGCCTCCCTGGTGCTGCGG - Intronic
1141954310 16:87359988-87360010 CTGGAGGCTGCCTGTTTCTCTGG - Intronic
1142123596 16:88399306-88399328 CCGGGGCCAGCCAGGTTCTGGGG + Intergenic
1142130766 16:88430575-88430597 CCCGAGCCTTCCTCTTCCTGGGG - Exonic
1142329860 16:89444943-89444965 TGGGAGCCTGCCTGCTCCTGTGG - Intronic
1142618639 17:1151626-1151648 CCTGAGAATGCCTGATTCTGGGG + Intronic
1143187489 17:5019433-5019455 ACTGAGCCTGCCAGTTTCTGGGG - Intronic
1144662563 17:17080659-17080681 CTGGAGCCTTCCTTGTTCTGGGG - Intronic
1145260076 17:21349367-21349389 CTGGATCCTGCCTGATTCCGTGG + Intergenic
1145316542 17:21738571-21738593 CTGGATCCTGCCTGATTCCGTGG - Intergenic
1145714965 17:27010478-27010500 CTGGATCCTGCCTGATTCCGTGG - Intergenic
1147237080 17:39065878-39065900 CTGGAGCCTGCATGTGCCTGTGG - Exonic
1151303134 17:73243439-73243461 CCGGAGCCTGCCAGGTGCAGTGG - Intronic
1151365906 17:73616357-73616379 CCTGAGCCTGCATGTGTGTGTGG - Intronic
1151624966 17:75270925-75270947 CTGGAGCCTTCCTCTTACTGGGG + Exonic
1152731883 17:81976673-81976695 CATGTGCCTGCCTGTCTCTGCGG - Intergenic
1154140382 18:11818432-11818454 CCTGAAACTGCCTGTTTCTAAGG + Intronic
1157593774 18:48851574-48851596 CCTGTGCCTGCCAGGTTCTGAGG - Intronic
1160425891 18:78778869-78778891 CCGGTGCCTGCCTGCTGCGGTGG - Intergenic
1160540971 18:79622641-79622663 CCTGGGCTTGCCTGTTTCTGCGG - Intergenic
1160990253 19:1857494-1857516 TCTGAGCCTGCCTGTTTCCGAGG - Intronic
1161201068 19:3015134-3015156 CCTGAGCCTGCCAGTCTCCGGGG + Intronic
1161256992 19:3315094-3315116 CCCGAAAGTGCCTGTTTCTGTGG + Intergenic
1162503379 19:11067513-11067535 CTGGAGCCTGCCATTTTGTGAGG + Intergenic
1163250120 19:16121883-16121905 CCGAAGCCTAGATGTTTCTGTGG + Intronic
1164865772 19:31603088-31603110 CTGGGGCTTGCCTGTGTCTGAGG + Intergenic
1166522585 19:43490805-43490827 CCCGAACCGGCCTGTTTCTATGG - Intronic
1166716707 19:44973136-44973158 CCGGGGCCCGCCTGGTCCTGAGG - Exonic
925092946 2:1169645-1169667 CCGGAGCCTGCAGGTTTTAGTGG - Intronic
928383686 2:30845835-30845857 ATGGATCCTGTCTGTTTCTGTGG - Intergenic
929933663 2:46277627-46277649 CCCGAGCCTGCCATTTTCTGTGG - Intergenic
932791636 2:74658593-74658615 CCCAAGCCTGCCTGTGTTTGAGG - Intronic
936911721 2:117600736-117600758 CCGGAGCCTGCCAGTGGGTGGGG + Intergenic
938082272 2:128376537-128376559 CCTGGGCCTTCCTGTTTCTCCGG + Intergenic
938196675 2:129334744-129334766 CCGCAGTGTGCCAGTTTCTGTGG + Intergenic
942298023 2:174535986-174536008 CTGCAGCTTGCCTGTTACTGGGG - Intergenic
946388322 2:219399839-219399861 CCGGGGCCTGTCTAGTTCTGTGG - Intronic
948148140 2:235723950-235723972 CCGGGGCCTGCCTGCCACTGAGG + Intronic
948338972 2:237233807-237233829 CCGGAGCCTCTCTGTTGCTATGG - Intergenic
948432491 2:237928715-237928737 CAGGAGCCTTCCAGGTTCTGGGG + Intergenic
948653874 2:239464975-239464997 CCGGTGCCTGCCACTGTCTGGGG + Intergenic
948802480 2:240439202-240439224 CGGGAGCCAGCCGGGTTCTGTGG - Intronic
1169234891 20:3922915-3922937 ACAGAACCTGACTGTTTCTGGGG - Intronic
1170896200 20:20416899-20416921 CAGGAGGCTGCCTGTGTCCGGGG - Intronic
1175237433 20:57524748-57524770 CCAAAGCCTGCCTGGCTCTGAGG - Intronic
1175519242 20:59589012-59589034 AGGGAGCCTCCCTGTTCCTGGGG - Intronic
1176412344 21:6455839-6455861 CCCCAGGCTGCCTGTTTCTGAGG - Intergenic
1178638937 21:34330319-34330341 CCGCAGCAGGCCTGTTCCTGAGG - Intergenic
1179687838 21:43064161-43064183 CCCCAGGCTGCCTGTTTCTGAGG - Intronic
1180160022 21:45994906-45994928 CCCGAGCTTGTCTGCTTCTGTGG + Intronic
1181439048 22:22926509-22926531 CCAGAGCCTGCGTGTGCCTGGGG - Intergenic
1184833270 22:47004536-47004558 CAGGAGCCTGCCTGTGTATATGG - Intronic
949895102 3:8762695-8762717 CCAGCCCCTCCCTGTTTCTGTGG - Intronic
952827525 3:37536768-37536790 CTGGACTCTGCCTGTTTCAGAGG - Intronic
953410453 3:42687938-42687960 CAGGAGCCTGCCTGGGTGTGGGG + Intronic
956559947 3:70564636-70564658 CCGGAGACAGCCATTTTCTGTGG - Intergenic
958558916 3:95717983-95718005 CCAGTGCCTGCCTGTATTTGGGG - Intergenic
958950222 3:100408512-100408534 AGGGGGCCTGCCTGTTGCTGTGG + Intronic
963225367 3:142856609-142856631 CCTTAGCCTTCCTGCTTCTGTGG - Intronic
966672624 3:182544931-182544953 CGGGAGCCTTTTTGTTTCTGTGG - Intergenic
967553105 3:190823002-190823024 CCAGAGCTTCCCTGGTTCTGGGG + Intergenic
967888873 3:194351128-194351150 CCGCAGCCTGCCTGGAGCTGCGG + Intronic
967997801 3:195179973-195179995 CTGGAGCCTGCCTGTGTTGGGGG - Intronic
968444823 4:646680-646702 CCGGAGGCTGCGCGTGTCTGAGG - Intronic
968529334 4:1082377-1082399 GGGGAGCGTGTCTGTTTCTGTGG + Intronic
968876018 4:3268378-3268400 CCTGGGCCTGGCTGCTTCTGTGG + Intronic
969238945 4:5887411-5887433 GTGGAGCCTGACTGTTCCTGAGG - Intronic
969490320 4:7495907-7495929 CAGGTGCCTCCCTGTTTCTCTGG - Intronic
969564660 4:7970815-7970837 CCGGCCCCTCCCTGTTGCTGTGG - Intronic
969946027 4:10783996-10784018 ACTGTGCCTGCCTGCTTCTGAGG - Intergenic
971196007 4:24472082-24472104 CCGGCTCCTGCCTCTTTCTCGGG + Intergenic
975428038 4:74253728-74253750 CAGGAGCTAGCCTGGTTCTGCGG - Intronic
977279506 4:95022106-95022128 AAGGAGCCTTCTTGTTTCTGCGG - Intronic
982169799 4:152649805-152649827 CCTGAACCTGCATATTTCTGGGG - Intronic
983870231 4:172817080-172817102 ACGGAGTCTGGCTGTTTCTCAGG - Intronic
985786442 5:1897809-1897831 CTGGTGCCTGCCTGTGCCTGAGG + Intergenic
985959037 5:3285823-3285845 CCTGAGCCTGGCTCTTTCCGTGG + Intergenic
986191437 5:5499761-5499783 CTGGAGCCTGCCTTTTTCCTGGG + Intergenic
987123181 5:14787021-14787043 CCGCACCCGGCCTGTTTCTTGGG - Intronic
989097054 5:37791462-37791484 CCAGAGCCTGCCAGCTTCTCAGG + Intergenic
992034653 5:72760666-72760688 CAGCAGCCTCCCTGGTTCTGAGG + Intergenic
997197130 5:131987708-131987730 CCTCAGCCTGTCTGTGTCTGAGG - Intronic
998815434 5:146009323-146009345 CTGGCCCCTGCCTGTCTCTGTGG + Intronic
998851593 5:146356083-146356105 CCAGACCATGGCTGTTTCTGAGG - Intergenic
999315615 5:150582214-150582236 ACCGACCCTGCCTGTTCCTGGGG - Intergenic
1001688208 5:173611642-173611664 CCGGAGCTAGGCTGTTTCGGGGG + Intronic
1005000971 6:21241362-21241384 CAGGAGCTTGCCTCTTACTGAGG - Intergenic
1005054945 6:21720633-21720655 CAGTAGCCTGCCTGTCTGTGAGG + Intergenic
1005403833 6:25464224-25464246 ACTGAGCCTGCCTATTTCTCTGG + Intronic
1007605858 6:43117533-43117555 CCTGAGCCTGCCATTTACTGGGG + Intronic
1011614743 6:89187171-89187193 CCTCAGCCTGGCTCTTTCTGTGG + Intronic
1016146236 6:140677765-140677787 CAAGAGCTTGCCTGTTTCTATGG - Intergenic
1018034062 6:159866805-159866827 CCGGGGCCTGGCTGTGCCTGGGG + Intergenic
1019119962 6:169794559-169794581 GGGGAGCCTGCCTGGTCCTGGGG - Intergenic
1019916848 7:4138949-4138971 CCGGAGCCTGCTAGGTTTTGAGG + Intronic
1020125148 7:5529447-5529469 CAGGAGCCTCCCGGTTTCCGGGG - Intronic
1023674414 7:42615364-42615386 CCGAAGCCTGACTGCTTCTGTGG - Intergenic
1025045516 7:55688971-55688993 CCACTGCCTGCCTTTTTCTGGGG + Intergenic
1026497916 7:70919548-70919570 CCAGAGCCTGCCAGTTACTCTGG + Intergenic
1028879127 7:95859753-95859775 CAGGATCCTGCCTGGTGCTGGGG + Intronic
1030646418 7:112066328-112066350 CCTGAGCCTTCCTGGTTCTGAGG + Intronic
1032057602 7:128696306-128696328 CCTGTGCCTGGCTGCTTCTGTGG + Intergenic
1032862718 7:135895958-135895980 ACTGAGCCTGGCTCTTTCTGGGG - Intergenic
1034419362 7:150980881-150980903 CCGCACCCTGCCTGTGACTGAGG + Intergenic
1034962057 7:155368954-155368976 TCTGAGTCTTCCTGTTTCTGTGG + Intergenic
1035546637 8:486805-486827 CAGGAGCCTGCCACGTTCTGAGG - Intergenic
1035741758 8:1933653-1933675 CCTGATCCTGGCTGTGTCTGGGG - Intronic
1036183818 8:6607371-6607393 CCCAAGTTTGCCTGTTTCTGTGG + Intronic
1040686116 8:49875178-49875200 CCGGGGTCTCCCTGTGTCTGAGG - Intergenic
1040834498 8:51718206-51718228 CCTGAGGCTGCCTGTGGCTGTGG - Intronic
1041433262 8:57808490-57808512 GCTGTGCCTGCCTGTATCTGGGG + Intergenic
1044305430 8:90635135-90635157 CCCCATTCTGCCTGTTTCTGAGG - Intronic
1045655707 8:104384143-104384165 CAGGAGGCTGCTTGTTTCTGAGG - Intronic
1047255813 8:123212735-123212757 CCGGAGCCTTGCTGCCTCTGGGG + Intergenic
1053835724 9:42133077-42133099 CTGAAACCTTCCTGTTTCTGTGG + Intergenic
1054594906 9:67055528-67055550 CTGAAACCTTCCTGTTTCTGTGG - Intergenic
1055934066 9:81588778-81588800 CTGGATCCCGCCTGCTTCTGAGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058596468 9:106621126-106621148 CTGGAGCCTGCCTGTAACAGGGG + Intergenic
1059043328 9:110838418-110838440 TCACAGCCTGCCTGTTTCTCTGG - Intergenic
1060447271 9:123701656-123701678 TGAGAGCCTGCCTGTTGCTGTGG - Intronic
1060666736 9:125436289-125436311 CCAGAGCCTCTCTGCTTCTGAGG - Intergenic
1061543492 9:131290588-131290610 CCGGAGCCTGCCTGTTTCTGGGG - Intronic
1061574385 9:131496976-131496998 CCGGAGCCTGCTGCTTTCTCTGG + Exonic
1061629585 9:131863683-131863705 GGGGAGCCTGGCAGTTTCTGAGG + Intronic
1062673089 9:137723176-137723198 CCGGGGTGTGCCTGTGTCTGTGG + Intronic
1062673110 9:137723250-137723272 CCGGGGTGTGCCTGTGTCTGTGG + Intronic
1185463177 X:341581-341603 CCTGACCCTGCCTGGATCTGGGG - Intronic
1188960914 X:36490551-36490573 ACGGAGCCTACCTGTTGGTGGGG - Intergenic
1194766508 X:97848650-97848672 GCGGAACCTGCATGTTTCTCGGG + Intergenic
1195135791 X:101906485-101906507 TGGGATCCTGCCTGGTTCTGGGG - Intronic
1196645926 X:118117055-118117077 CCAGAGCCTCCCGGTTTCCGAGG - Intronic
1197882232 X:131178851-131178873 CCTTACCCTGCCTGCTTCTGTGG + Intergenic
1198099785 X:133414311-133414333 CCGGAGCTTGCTAGATTCTGGGG - Intronic
1202179834 Y:22130289-22130311 CCTGAGGCTGCATGGTTCTGTGG + Intergenic
1202211527 Y:22456105-22456127 CCTGAGGCTGCATGGTTCTGTGG - Intergenic