ID: 1061543864

View in Genome Browser
Species Human (GRCh38)
Location 9:131292467-131292489
Sequence CAATTTCCCCCTCTTTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2610
Summary {0: 1, 1: 0, 2: 19, 3: 304, 4: 2286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061543864_1061543870 -4 Left 1061543864 9:131292467-131292489 CCCATTTAAAGAGGGGGAAATTG 0: 1
1: 0
2: 19
3: 304
4: 2286
Right 1061543870 9:131292486-131292508 ATTGAGGCATGGGGTGACGATGG No data
1061543864_1061543871 4 Left 1061543864 9:131292467-131292489 CCCATTTAAAGAGGGGGAAATTG 0: 1
1: 0
2: 19
3: 304
4: 2286
Right 1061543871 9:131292494-131292516 ATGGGGTGACGATGGTTCTAAGG No data
1061543864_1061543872 26 Left 1061543864 9:131292467-131292489 CCCATTTAAAGAGGGGGAAATTG 0: 1
1: 0
2: 19
3: 304
4: 2286
Right 1061543872 9:131292516-131292538 GTCCTGCAGCTAGTCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061543864 Original CRISPR CAATTTCCCCCTCTTTAAAT GGG (reversed) Intronic
Too many off-targets to display for this crispr