ID: 1061544859

View in Genome Browser
Species Human (GRCh38)
Location 9:131298768-131298790
Sequence TGGCCAGGGAACCAGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 287}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061544859_1061544878 17 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544878 9:131298808-131298830 CCTGGGCTAGGGGAGAAGGGTGG No data
1061544859_1061544869 5 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544869 9:131298796-131298818 AACCCCGAGGGACCTGGGCTAGG No data
1061544859_1061544870 6 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544870 9:131298797-131298819 ACCCCGAGGGACCTGGGCTAGGG No data
1061544859_1061544862 -8 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544862 9:131298783-131298805 CCTGGCCACCACCAACCCCGAGG No data
1061544859_1061544863 -7 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544863 9:131298784-131298806 CTGGCCACCACCAACCCCGAGGG No data
1061544859_1061544881 29 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544881 9:131298820-131298842 GAGAAGGGTGGGCCTCGAGGTGG No data
1061544859_1061544876 14 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544876 9:131298805-131298827 GGACCTGGGCTAGGGGAGAAGGG No data
1061544859_1061544879 18 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544879 9:131298809-131298831 CTGGGCTAGGGGAGAAGGGTGGG No data
1061544859_1061544867 0 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544867 9:131298791-131298813 CCACCAACCCCGAGGGACCTGGG No data
1061544859_1061544882 30 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544882 9:131298821-131298843 AGAAGGGTGGGCCTCGAGGTGGG No data
1061544859_1061544880 26 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544880 9:131298817-131298839 GGGGAGAAGGGTGGGCCTCGAGG No data
1061544859_1061544872 7 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544872 9:131298798-131298820 CCCCGAGGGACCTGGGCTAGGGG No data
1061544859_1061544865 -1 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544865 9:131298790-131298812 ACCACCAACCCCGAGGGACCTGG No data
1061544859_1061544875 13 Left 1061544859 9:131298768-131298790 CCAGCACTCTGGTTCCCTGGCCA 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1061544875 9:131298804-131298826 GGGACCTGGGCTAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061544859 Original CRISPR TGGCCAGGGAACCAGAGTGC TGG (reversed) Intronic
900177977 1:1299087-1299109 AGGCCAGGGAAGCAGAGGGGAGG + Intronic
900415219 1:2531622-2531644 TGGCCAGGGAACCCCACTCCTGG - Intergenic
901451363 1:9338598-9338620 TTGCCTGGGAACCAGAGAGTTGG + Intronic
901643918 1:10706595-10706617 TGTCCTGGGAACCGGAGAGCGGG - Intronic
902728864 1:18355475-18355497 TGGCCATGGAACAGGAGTGATGG + Intronic
902769091 1:18635280-18635302 TGGCCAGGGGTCCAGTGTGGAGG + Intronic
903067679 1:20709889-20709911 TGGTCAAGGAACCAGAGAGAAGG + Intronic
903218177 1:21854568-21854590 TGGCAGGGGACCCAGGGTGCAGG - Intronic
904565350 1:31425287-31425309 TGGACAAGGAAGCTGAGTGCAGG - Intronic
905036017 1:34918757-34918779 TGGCCAGGGCCCCACAGTGCAGG + Intronic
905252629 1:36659328-36659350 TGCCCAGGGACCCAGGGTACAGG - Intergenic
905337795 1:37257430-37257452 TGGCCAGGGACACAGAGAACAGG + Intergenic
906032731 1:42734071-42734093 TGGCCAGGGAGACTGAGTCCCGG + Exonic
906577018 1:46900265-46900287 TGGCCATAGAACCAGTGCGCAGG + Intergenic
906594947 1:47067638-47067660 TGGCCATAGAACCAGTGGGCAGG - Exonic
907998277 1:59654970-59654992 TGCCCAGGGACACAGAGTGGGGG - Intronic
908284875 1:62585585-62585607 TTGCCAGGGAACCAGAGCACTGG - Intronic
908959714 1:69681688-69681710 TGGACAGAGAACAAGAGTGTAGG - Intronic
911994349 1:104745436-104745458 TGGCCAGGGCACAAGAAAGCAGG - Intergenic
912656002 1:111486861-111486883 TGGCCTGGCAAGCAGAGTGTGGG - Intronic
914748112 1:150514178-150514200 TGGCCAGGCTCCCAAAGTGCTGG + Intergenic
916651416 1:166838337-166838359 TGGTCAGGGGACCAGGGTGGAGG - Intergenic
916891211 1:169114058-169114080 AGGCCAGGCCAGCAGAGTGCCGG + Intronic
918107131 1:181424928-181424950 TGGCCATGGGAGCAGAGTGGAGG - Intronic
919768410 1:201141859-201141881 TAGCCAGGGAGCCAGAGGGAGGG - Intronic
920025153 1:202988707-202988729 TGCCCAGGGAAGCCGAGTGTGGG + Intergenic
920649207 1:207824201-207824223 TGGCCAAGGAAGCAGAGTGTAGG - Intergenic
920700802 1:208216974-208216996 TGGCCAGGTAAGCAGCCTGCAGG + Exonic
921939778 1:220827736-220827758 TGGCCAGGAAACCAGAGACTAGG + Intergenic
922465270 1:225842311-225842333 AGGCCTGGGGACCAGAGAGCTGG - Intronic
922737993 1:227999690-227999712 TGGCCTGGGAACCAGGATTCTGG + Intergenic
922988234 1:229883202-229883224 TGGTCAGTAACCCAGAGTGCTGG + Intergenic
923524370 1:234760660-234760682 AGGCCAGGGCACCACAGTGCAGG + Intergenic
924502580 1:244651480-244651502 TGGCCAGGGAAGGATAGTCCGGG + Intergenic
924611384 1:245576574-245576596 TGGCCAGGCACACGGAGTGCAGG - Intronic
1064352872 10:14592782-14592804 TGCCCAGGCTACCAGTGTGCAGG - Intronic
1064910881 10:20400713-20400735 TAGCCTGGGAATCAAAGTGCAGG - Intergenic
1065494172 10:26312066-26312088 TGGACAGAGACCCAGAGGGCTGG + Intergenic
1066196160 10:33102285-33102307 TGGCCAGCAGACTAGAGTGCAGG + Intergenic
1067225798 10:44374949-44374971 TGGGCAGGGAAGGAGGGTGCAGG + Intronic
1067346415 10:45441815-45441837 GGACCCGGGAAGCAGAGTGCTGG - Intronic
1067401277 10:45976006-45976028 TGGCCAGGCTCCCAAAGTGCTGG + Intronic
1067869627 10:49945585-49945607 TGGCCAGGCTCCCAAAGTGCTGG + Intronic
1070125951 10:73621970-73621992 TGGCCAGGACACCAGAATTCTGG - Intronic
1070344848 10:75531638-75531660 TGTCCAGAGAACAAGAGTGCTGG - Intronic
1071571780 10:86701137-86701159 TGGCCCGGGCATCAGACTGCTGG - Intronic
1072745052 10:97933966-97933988 TGGGCAGGGAACCAGGGCTCTGG + Intronic
1073206267 10:101770955-101770977 GGGCCAGGGAACCGAAGTCCTGG - Intronic
1074352787 10:112754717-112754739 TGGCCAGGCACCCAGCATGCAGG + Intronic
1074831212 10:117250778-117250800 TAGGCAGGGAACCAGCATGCTGG - Intronic
1075055836 10:119217764-119217786 CGGCCAGGGAAGCAGGGTGCAGG - Intronic
1075255897 10:120925949-120925971 AGGCCAGGCAGCCAGATTGCCGG - Intergenic
1075526151 10:123188966-123188988 TGGCCGGGGAGCCAGGGGGCTGG + Intergenic
1075747878 10:124740785-124740807 TGGCCAGGGGACTTGGGTGCTGG - Intronic
1076042120 10:127259175-127259197 TGGCCCGGGGAGCAGAGTGGGGG + Intronic
1076173493 10:128343322-128343344 TGGCCATGGGACTAGGGTGCAGG - Intergenic
1076992890 11:284803-284825 TGGCCAGGGCTTCAGAGGGCAGG - Intronic
1077156416 11:1093990-1094012 TTGCCAAAAAACCAGAGTGCAGG - Intergenic
1077429822 11:2510853-2510875 GGGCCAGGGGAGCAGAGTGATGG - Intronic
1077660203 11:4061209-4061231 TAGCATGGGAACCAGAATGCTGG + Intronic
1078001415 11:7499725-7499747 TGGTCAGGGAAACATAGTTCTGG - Intronic
1078354386 11:10623336-10623358 TGGACAGGGAACCAGAGGCTTGG + Intronic
1079008811 11:16811816-16811838 TGGCCAGGGCAGCAGAGGGGAGG - Intronic
1080766977 11:35306034-35306056 TTGCCAGGGAAGCAGAATCCCGG + Intronic
1082807895 11:57461661-57461683 TGGACAGGGACCCAGAATCCTGG + Intronic
1083147838 11:60772187-60772209 TGGACAGGGGACCAGAGTGCTGG + Intronic
1083330727 11:61897251-61897273 TGGCCAGAGCCCCAGGGTGCAGG + Intergenic
1085147009 11:74209648-74209670 TGGGCAGGAAACCACAGTGGAGG + Intronic
1086091360 11:83008159-83008181 TGGCCAGGGAGCCAGAGGTCAGG + Intronic
1086443355 11:86849826-86849848 TGACTAGGGAGTCAGAGTGCAGG - Intronic
1087190826 11:95252467-95252489 TGAACAGGGAGCCAGAGAGCTGG + Intergenic
1087836028 11:102875999-102876021 TGGCCTGGGAAACAGTCTGCTGG + Intergenic
1088359262 11:108973899-108973921 ACGCCAGGGGACCAGAGTGTTGG + Intergenic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1091991575 12:4960251-4960273 TGGGCTGGGAACCCGAGGGCTGG - Intergenic
1092938243 12:13383916-13383938 AGGCCAGGGAAGCGGGGTGCAGG - Intronic
1096482121 12:51949447-51949469 AGATCAGGGAACCAGAATGCTGG - Intergenic
1097078645 12:56413312-56413334 TGGCCAGGTCACAACAGTGCTGG + Intergenic
1100279318 12:93103312-93103334 TGGGCTGGAAACCAGAGAGCTGG - Intergenic
1102035424 12:109768381-109768403 GGCCAAGGGACCCAGAGTGCTGG - Exonic
1103013234 12:117474062-117474084 TTGGCAGGAAACCAGAGAGCCGG + Intronic
1103508020 12:121454453-121454475 GGGGCTGGGAACCAGAGGGCAGG - Intronic
1103935818 12:124475958-124475980 CTTCCAGGGACCCAGAGTGCAGG + Intronic
1104960961 12:132488618-132488640 TTGACAGGGAACCAGAGAGCGGG + Intergenic
1106817905 13:33429764-33429786 TGGCAAGGGTAGCAGGGTGCTGG + Intergenic
1107728792 13:43327293-43327315 TGGTCTGGGAGCCAGAGGGCGGG - Intronic
1112449921 13:99499063-99499085 TGGCCAGGCCACAAGAGTGCTGG - Intergenic
1112787682 13:102968994-102969016 TTGCCGGGAAGCCAGAGTGCTGG + Intergenic
1113467113 13:110520332-110520354 TGGGGAGGGAACCCGTGTGCTGG + Intergenic
1113467137 13:110520404-110520426 TGGGGAGGGAACCCGTGTGCTGG + Intergenic
1113543927 13:111131684-111131706 AGGTCAGGGGACGAGAGTGCTGG + Intronic
1114049689 14:18913058-18913080 TGGCCAGGCAGGCAGCGTGCAGG - Intergenic
1114112871 14:19488872-19488894 TGGCCAGGCAGGCAGCGTGCAGG + Intergenic
1117092895 14:52268185-52268207 TGGCCATGGCACTGGAGTGCTGG + Exonic
1118034962 14:61856828-61856850 TGGCCAAGGACCCAGAGTTTAGG + Intergenic
1122088297 14:99321922-99321944 TGGACAGAGAACCTGACTGCAGG + Intergenic
1122097157 14:99380652-99380674 TGCCCAGGGGACCAGAGCACAGG - Intergenic
1122158302 14:99764401-99764423 TGGCCAGGGAAGTGGAGTGGAGG - Intronic
1122459320 14:101882322-101882344 TGGCCTGGGATCCACAGAGCGGG + Intronic
1122791250 14:104185109-104185131 TTCCCAGGGAACCAGGGTGTGGG - Intergenic
1123042785 14:105497200-105497222 TGGCCAGAGAACCTGGGCGCAGG + Intronic
1123184416 14:106502665-106502687 TGGCCAGGGCTCCAGAGTTCAGG + Intergenic
1123398469 15:19960611-19960633 TGGCCAGGACTCCAGAGTTCAGG + Intergenic
1124007037 15:25802723-25802745 AGATGAGGGAACCAGAGTGCCGG - Intronic
1124945123 15:34258504-34258526 TGGCAAGGGATCCAGAGTGGAGG - Intronic
1125468266 15:39976602-39976624 TGGCCAGGGGCCCGGAGTCCGGG - Exonic
1128897903 15:71392645-71392667 TGGCTATGGAACCATAATGCTGG + Intronic
1129205765 15:74036230-74036252 TGGCCAGGGACTCAGAATACAGG - Intronic
1129333442 15:74839253-74839275 TGGCCTGGGACTCACAGTGCAGG + Exonic
1129365318 15:75050508-75050530 TGGCCTGGAAGCCAGAGGGCAGG - Exonic
1129405387 15:75313604-75313626 TGCCCAGGGCTCCAGAGGGCAGG + Intergenic
1129939491 15:79481772-79481794 TAGCCAGGGGACCTGAGTGATGG - Intergenic
1130585038 15:85174158-85174180 TGCCCAGGGTTCCAGAGGGCAGG + Intergenic
1132410824 15:101577179-101577201 GGGCCAGGGATGCAGAGAGCCGG - Intergenic
1133191029 16:4133796-4133818 TGCCCAGGGAACCAGCATGCTGG - Intergenic
1134044323 16:11090131-11090153 CTTCCAGGGAACCAGAATGCAGG - Intronic
1134244886 16:12532700-12532722 TGCCCAGGGAAAGAGAGGGCAGG + Intronic
1134393276 16:13839507-13839529 TGGCCAGGAGACCAGAGAGGAGG - Intergenic
1135237948 16:20775999-20776021 TGCCCAGGGTCCCAGAGTGGTGG + Exonic
1136237110 16:28921364-28921386 TGGCCAGGCAGGCAGAGTGAGGG - Intronic
1137811844 16:51359889-51359911 TTGCCAGGGAACCAGAGCTCTGG - Intergenic
1137882089 16:52059979-52060001 TGGTCAAGGAAGCAGAGAGCAGG + Intronic
1138224212 16:55278697-55278719 TGTCCAAGAAACCAGAGTGAGGG + Intergenic
1138435997 16:57000388-57000410 TGGGCTGGGACCCAGATTGCTGG + Intronic
1138551695 16:57752227-57752249 GGGCCAGGGAACCAGAGCCAGGG - Intronic
1139461840 16:67128782-67128804 TGGCAATGGACCCAGAGTGCTGG - Intronic
1139622299 16:68155596-68155618 TGGCGAGGGAATCTGAGAGCTGG - Intronic
1139884122 16:70196810-70196832 AGGCCAGGGAAGCAGAGGGCAGG - Intergenic
1140287837 16:73621398-73621420 TTGCCAGGGAATGAGACTGCTGG - Intergenic
1140368396 16:74398686-74398708 AGGCCAGGGAAGCAGAGGGCAGG + Intergenic
1141700727 16:85640895-85640917 TGGCCCGGGGGCCAGAGGGCTGG + Intronic
1142811263 17:2396686-2396708 TAGCCAGGGAACCAGAATGGTGG - Intronic
1143135873 17:4711942-4711964 TGGCCAAGGAGGCAGAGTGTGGG - Intronic
1143860721 17:9888807-9888829 TTCCCAGGGAAGCAGAGAGCTGG - Intronic
1145741795 17:27281025-27281047 GGGCCAGGGAGACAGAGTGCTGG + Intergenic
1146168816 17:30616385-30616407 TGGGCAGGGATCCAGGGTGTAGG + Intergenic
1146170747 17:30631063-30631085 TGGGCAGGGATCCAGGGTGTAGG - Intergenic
1146344194 17:32047082-32047104 TGGGCAGGGATCCAGGGTGTAGG - Intronic
1146687368 17:34850268-34850290 TGGCTCTGGAATCAGAGTGCTGG + Intergenic
1146843648 17:36170522-36170544 TGGCCCGGGAACCTCACTGCCGG + Intronic
1146855955 17:36258460-36258482 TGGCCCGGGAACCTCACTGCCGG + Intronic
1146864665 17:36329915-36329937 TGGCCCGGGAACCTCACTGCCGG - Intronic
1146871861 17:36382371-36382393 TGGCCCGGGAACCTCACTGCCGG + Intronic
1146879222 17:36433453-36433475 TGGCCCGGGAACCTCACTGCCGG + Intronic
1146883155 17:36454599-36454621 TGGCCCGGGAACCTCACTGCCGG + Intergenic
1147067527 17:37930509-37930531 TGGCCCGGGAACCTCACTGCCGG - Intronic
1147074747 17:37982995-37983017 TGGCCCGGGAACCTCACTGCCGG + Intronic
1147079056 17:38010064-38010086 TGGCCCGGGAACCTCACTGCCGG - Intronic
1147086270 17:38062534-38062556 TGGCCCGGGAACCTCACTGCCGG + Intronic
1147094995 17:38134006-38134028 TGGCCCGGGAACCTCACTGCCGG - Intergenic
1147102216 17:38186499-38186521 TGGCCCGGGAACCTCACTGCCGG + Intergenic
1148588652 17:48799153-48799175 TGGCCAGGGGACAACATTGCAGG - Intronic
1149287147 17:55177255-55177277 TGGGCAAGGAACAAGAGTGGAGG + Intergenic
1149492715 17:57096662-57096684 TGGGCCAGGAATCAGAGTGCTGG - Exonic
1149846802 17:60013010-60013032 TGGCCCGGGAACCTCACTGCCGG + Intergenic
1149945141 17:60917313-60917335 GGGCCTGGGAAACAGAGTACTGG - Intronic
1150085152 17:62269584-62269606 TGGCCCGGGAACCTCACTGCCGG + Intergenic
1150977851 17:70109110-70109132 TGGACATGGAATCAGAGTGATGG - Intronic
1151392604 17:73797743-73797765 TGGCCAGGGGCCCAGAGGGGTGG + Intergenic
1151552713 17:74831257-74831279 AGTCCAGGGTACCAGAGTCCAGG - Intronic
1152128040 17:78459210-78459232 TAGCGAGGGAACCAGAGGGCCGG + Intronic
1152507759 17:80762407-80762429 TGGCGAGGGCCCCAGGGTGCAGG + Intronic
1152709515 17:81863990-81864012 TAGCCAGGGTAGCAGAGGGCAGG + Intergenic
1152893520 17:82896399-82896421 ATGCCAGAGAACAAGAGTGCAGG - Intronic
1154144144 18:11852120-11852142 TGGCCAGGAAACCTCAGAGCGGG - Exonic
1154315470 18:13300374-13300396 GGGCCTGGGAACTAGAGGGCAGG + Intronic
1156872199 18:41958565-41958587 TGGCCAGATCACCAGAGTTCAGG - Intronic
1157693248 18:49700754-49700776 TTGCTAGGGAGCCAGAGAGCAGG + Intergenic
1160534794 18:79586072-79586094 TGGCACAGCAACCAGAGTGCAGG - Intergenic
1160807021 19:996392-996414 TGTCCAAGGACCCAGCGTGCAGG - Intronic
1160979873 19:1812007-1812029 TGGACAGGGCTCCAGAGTCCAGG + Intronic
1161160811 19:2761038-2761060 AGGCAAGGGAAGCAGAGCGCCGG - Intronic
1163746672 19:19052791-19052813 TGGCCACAGAACCAGAGTGACGG - Intronic
1163827372 19:19531121-19531143 AGGCCAGGTAGGCAGAGTGCAGG - Intronic
1165003678 19:32787223-32787245 TGCCCAGGGAAACAGGGTGTGGG - Intronic
1165750516 19:38256557-38256579 TGGGCGGGGACCCAGAGTCCCGG + Exonic
1166037736 19:40181380-40181402 TGGCCAGAGAATCAGAGAACTGG + Intergenic
1167089034 19:47330544-47330566 TAGTCAGGGAAACAGAGTGGAGG + Intergenic
1167320943 19:48796872-48796894 GGGCCAGGGCATCAGAGGGCTGG - Intronic
1167428280 19:49440869-49440891 TGGCCAGAGAACCAGAGAGAGGG + Intronic
1167558907 19:50213509-50213531 TGGCCAGGGAGCCAGACTTTTGG + Intronic
1167752896 19:51391124-51391146 GGGCTGGGGAACCAGAGTACGGG - Intergenic
925312161 2:2892529-2892551 GGGCCAGGGATCCGGAGTGCAGG - Intergenic
925890118 2:8426531-8426553 TGGACAAGGAAGCAGAGTGTTGG + Intergenic
926573975 2:14560007-14560029 TGGCCAGGCACCCATGGTGCTGG - Intergenic
927032299 2:19133861-19133883 AAGCCAGGGAACCAGAATGCAGG + Intergenic
927755215 2:25702773-25702795 TGGTCAGGGTGCCACAGTGCAGG - Intergenic
928198081 2:29229125-29229147 TGGCCAGAGAAGCAGGATGCAGG + Intronic
929605071 2:43228049-43228071 GGCCCAGGGAGCCAGAGTCCAGG + Intergenic
930005448 2:46892626-46892648 ATGCCAGGGAATCAGAGTGCAGG - Intergenic
930857481 2:56034233-56034255 TTGCTAGAGAACCAGAGTGAAGG + Intergenic
931569945 2:63657825-63657847 TGGACAGGGAACCAGACTGAGGG - Intronic
931905295 2:66836238-66836260 TGGCCAGGGGCCCAGTGTTCAGG + Intergenic
932626143 2:73297460-73297482 TCGCCATGGAGACAGAGTGCTGG - Intergenic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
937395954 2:121534925-121534947 TATCCAGGGACCCAGAGTCCAGG - Intronic
937451931 2:122009441-122009463 TGTCCTGGGACCCAGAGAGCTGG + Intergenic
938288542 2:130137498-130137520 TGGCCAGGCAGGCAGCGTGCAGG + Intergenic
938427046 2:131201393-131201415 TGGCCAGGCAGGCAGCGTGCAGG - Intronic
938467990 2:131535436-131535458 TGGCCAGGCAGGCAGCGTGCAGG - Intergenic
941677028 2:168355030-168355052 GGGCAAGAGAACCAGAGTGATGG - Intergenic
945473574 2:210255369-210255391 TAGCTTGAGAACCAGAGTGCTGG + Intergenic
946418027 2:219550356-219550378 AGGCCAGGGGACCAGGGTGAGGG - Exonic
948186612 2:236026311-236026333 TGGCCAGGGAGCCAGACACCCGG + Intronic
948487059 2:238288017-238288039 AGGCCTGGGAACCTGAGGGCGGG - Intronic
1168851356 20:979197-979219 TGGCCAGGGAAGGTGAGTGGTGG - Intronic
1170536470 20:17345894-17345916 TGGCCATGGAAACAGAGTCAAGG + Intronic
1170991124 20:21303025-21303047 TGCCCAGGGAGCCGGAGGGCTGG + Intergenic
1173611613 20:44372407-44372429 TGGCCAGCTAACCAGGGTGGAGG - Intronic
1173872223 20:46349231-46349253 TGGCCCGGGAACCAGTTTACAGG + Intronic
1175952497 20:62590890-62590912 TGCTCAGGGAACCAGAATGAGGG - Intergenic
1176060418 20:63170052-63170074 TGGCGGGGGAACCAGGGTGAAGG + Intergenic
1176745159 21:10645354-10645376 TGGCCAGGACTCCAGAGTTCAGG + Intergenic
1178544008 21:33478864-33478886 TGTCAAGGGATCCACAGTGCAGG + Intronic
1178768885 21:35483879-35483901 CTGCAAGGGAACCAGAGTGGGGG + Intronic
1179967626 21:44816694-44816716 TGGCCAGTGCACCTGAATGCAGG + Intronic
1180027944 21:45179115-45179137 TGGCCAGGGTGCCAGAGGGAAGG - Intronic
1180468169 22:15635434-15635456 TGGCCAGGCAGGCAGCGTGCAGG - Intergenic
1180711179 22:17840781-17840803 TGGATAGGGAAGCAGAGTTCTGG + Intronic
1180733540 22:18000036-18000058 CGGCCAGGTAACCAGAAGGCGGG + Intronic
1180954855 22:19737021-19737043 TGCCCAGGGGTCCAGGGTGCCGG + Intergenic
1181266367 22:21633196-21633218 CGGCCAGGTAACCCGAGTGGTGG - Exonic
1181496084 22:23288343-23288365 TGGCAGGGGAACAAGAGGGCTGG - Intronic
1181967482 22:26667063-26667085 TGGCCAGGGAGCCAGGTGGCTGG + Intergenic
1182845357 22:33426482-33426504 TAGCCAGGGTCCCAGAATGCTGG + Intronic
1183669925 22:39266499-39266521 TGGCCAGGAAGTCAGAGTCCTGG - Intergenic
1184923468 22:47621721-47621743 TGAGCAGGGAAACAGAGTTCTGG + Intergenic
950467320 3:13163068-13163090 GCTCCAGGGAACCAGAGTCCAGG - Intergenic
951564705 3:24001895-24001917 TGGCCAGCGTACCAGAGAGGAGG - Intergenic
952003104 3:28809156-28809178 TGGCCAGGCAACCAGAGCCTCGG - Intergenic
953475054 3:43198438-43198460 AGGGCAGGGAACCAGAGAGGAGG + Intergenic
953907623 3:46876229-46876251 TGGCCAGGGAAGCAGGAGGCTGG - Intronic
954778025 3:53037259-53037281 TGACAAGGGAAGCAGAGGGCTGG - Intronic
955213787 3:56966558-56966580 TGGACAGGGAAGCAGAGTCAGGG + Intronic
956272291 3:67460994-67461016 TGGGCAGTGAACCTGAGTGCTGG - Intronic
957999784 3:87736620-87736642 TGGCCAGGGCCCCACAGTGTGGG + Intergenic
961180122 3:124869760-124869782 TGGACAGGGAACCTAAGTGTGGG + Intronic
966499832 3:180626679-180626701 TGGCCTTGCAACCAGAATGCAGG + Intronic
967051619 3:185789959-185789981 TGGGCAGGTAACCTGAGTTCAGG - Intronic
967938371 3:194747327-194747349 TGGGCTGGGAACCAGAAGGCTGG + Intergenic
968040996 3:195589174-195589196 AGGGGAGGGATCCAGAGTGCAGG + Intergenic
968908877 4:3466638-3466660 AGGACAGGGAATCAGAGAGCTGG + Intronic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
972106406 4:35494220-35494242 GGGCCAGGGAAGCAGAGAGCTGG - Intergenic
972308045 4:37851203-37851225 AGGCTGGGGAAACAGAGTGCTGG + Intronic
972386852 4:38575178-38575200 TAGCCAGGGAAGCAGGGTCCTGG + Intergenic
976055835 4:81065563-81065585 TAGCCAGGAAATCAGAATGCAGG - Intergenic
977160583 4:93629332-93629354 TGTCCAGGGAATCAGGATGCAGG - Intronic
982590006 4:157296661-157296683 TGCCCAGGGAAACATAGAGCTGG + Intronic
985245604 4:187977076-187977098 TGGCAAGAGAGCCTGAGTGCCGG + Intergenic
985821650 5:2164497-2164519 AAACCAGGGAACCAGAGAGCAGG - Intergenic
985839578 5:2296124-2296146 TGGCCAGATACCAAGAGTGCAGG + Intergenic
985916669 5:2925148-2925170 TGGCCAGAGAACCAGAGACACGG - Intergenic
989439087 5:41448999-41449021 TGGGCAAGGAACCATAGTGTGGG - Intronic
990616105 5:57510046-57510068 CGGGGAGGGAACCAGGGTGCTGG + Intergenic
997354214 5:133252020-133252042 TGTCCAGGGAAGCAGCGTGGTGG - Intronic
997473654 5:134130479-134130501 TGGCTTGGGAAGCACAGTGCAGG - Intronic
998174471 5:139893489-139893511 TGGCCATGGGTGCAGAGTGCTGG - Intronic
998270976 5:140706224-140706246 TGGCTAGAGAACCATAGGGCAGG - Exonic
998458151 5:142289668-142289690 TGGCCAGGCTTCCAGAGGGCAGG + Intergenic
999382932 5:151134468-151134490 TGCCCAGGGAACCAGGGAGGAGG - Exonic
999426033 5:151488399-151488421 GGGCCAGGTAACCTGAGGGCAGG + Exonic
999904175 5:156121410-156121432 TGGCCAGGGTTCCACAGTGGTGG + Intronic
1000979532 5:167801702-167801724 TGGCCAGGAATGCAGAATGCAGG + Intronic
1002356919 5:178637492-178637514 TGCCCAGGGAACCTGTGTGTGGG + Intergenic
1004370861 6:15051094-15051116 TGGGCAGGGATTCAGGGTGCTGG - Intergenic
1004485710 6:16064608-16064630 TGACCAGGGAACTAGAATTCAGG - Intergenic
1004664906 6:17740838-17740860 GCCCCAGGGAAGCAGAGTGCTGG + Intergenic
1005809112 6:29502777-29502799 TCCCCAGGGAAGCGGAGTGCTGG - Intergenic
1006387760 6:33741111-33741133 TGGCCAGGGAAAGAGAATGGGGG - Intronic
1007097298 6:39221430-39221452 TGGACAGGAAACCAGAGGCCAGG - Intronic
1007269494 6:40625570-40625592 TGGCCAGGGATCCTTAGTGCTGG - Intergenic
1008661635 6:53674172-53674194 TGACCAGGTAACCAGAATGGAGG + Intergenic
1009799075 6:68509897-68509919 TGGCCAGGGAACCAGAGATATGG + Intergenic
1011746714 6:90413602-90413624 AGGGCTGGGACCCAGAGTGCGGG + Intergenic
1012043870 6:94243900-94243922 TGTCCAGGTATCCAGGGTGCAGG - Intergenic
1014253691 6:119140618-119140640 AGGCGAGGGAACCAGATTGCAGG - Intronic
1014999390 6:128196067-128196089 TGACCTGGGAACCAGAGGACAGG + Intronic
1016330321 6:142946819-142946841 AGGCCAGGGATCCGGAGTACTGG - Intergenic
1017636364 6:156447469-156447491 AGGCCAGGGAACCAGCGAGTGGG + Intergenic
1017822852 6:158061435-158061457 TGGTCAGGGAGCCAGAGTGAAGG - Intronic
1018794137 6:167172674-167172696 TGGCCAGGGCCACACAGTGCAGG + Intronic
1018840597 6:167514075-167514097 TGTCCAGCCAACCAGAGTGGTGG - Intergenic
1018941411 6:168310676-168310698 GGGCCAGGGCTGCAGAGTGCAGG - Intronic
1019191736 6:170255099-170255121 AGGCCATGGCACCAGAGTCCGGG - Intergenic
1019277023 7:181266-181288 TTGCCAGGGAGCCCGAGAGCTGG - Intergenic
1019416880 7:931948-931970 TGGCCAAGGGGCCTGAGTGCAGG + Intronic
1019572734 7:1720482-1720504 GAGCCAGGGAACCAGCGTGCAGG + Intronic
1019910410 7:4097088-4097110 AAGCCTGGGAACCAGTGTGCTGG - Intronic
1020136700 7:5591970-5591992 TGGCCTGGGAACCAGAGACCTGG + Intergenic
1020477209 7:8610901-8610923 TGGGCATGGAACAAGTGTGCTGG + Intronic
1024096061 7:45983710-45983732 TGGCCAGGGCCCCACAGTGAAGG - Intergenic
1026930797 7:74221925-74221947 AGGGCAGGGAACTAGAGGGCTGG + Intronic
1028480887 7:91303412-91303434 TAGCCAGGGGAGCAGAGTGCTGG + Intergenic
1029384034 7:100231939-100231961 TCCCCAGGGAACTAGAGTGTGGG - Intronic
1030202350 7:106918409-106918431 TGGCTAGGGAAACAGAGTCAGGG - Intergenic
1032808500 7:135383434-135383456 AGGACATGGAAGCAGAGTGCTGG - Intronic
1033602281 7:142896925-142896947 TGGCCTGGGACCCAGAGGGAAGG + Intergenic
1035316298 7:157999528-157999550 TGGCCTGGGAACCTGAGTTCTGG + Intronic
1038421662 8:27437693-27437715 GAGCCAGGGGACCAGGGTGCTGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1041636779 8:60153690-60153712 TGGCCAGAGTACCAGAGGGGAGG - Intergenic
1044674981 8:94719811-94719833 CGGCCCGGGAACCAGAGTGTTGG - Intronic
1044847635 8:96397860-96397882 TGGTGAGGAAACCAGAGAGCAGG - Intergenic
1045509902 8:102806343-102806365 TGGGAAGGGAACCCGAGGGCGGG - Intergenic
1046945218 8:119968055-119968077 TGGACAGGGAAGCACAGTGCTGG + Intronic
1047074229 8:121381926-121381948 TGCCTAGGGAGTCAGAGTGCTGG + Intergenic
1049195328 8:141312674-141312696 GGGCCAGGGAAGCTGAGGGCAGG - Intergenic
1049246823 8:141567331-141567353 TGGCCAGGGGGCCAGAGTGCAGG + Intergenic
1050356913 9:4792647-4792669 TGGCCAGGGAACCCCGGCGCGGG - Intergenic
1050537692 9:6645115-6645137 CGGCCCGGGACCCAGGGTGCGGG + Intronic
1051585387 9:18721638-18721660 TGGGCAGGGATCCAAATTGCAGG - Exonic
1051944658 9:22553532-22553554 TAGACAGAGAACAAGAGTGCAGG - Intergenic
1053131021 9:35615818-35615840 GGGGCAGTGAACCAGAGTGGTGG - Intronic
1053466940 9:38315699-38315721 TGGCCAGGGAATCTGAGTGCTGG - Intergenic
1054830558 9:69620378-69620400 TGGTCAGAGAGACAGAGTGCCGG + Intronic
1055707204 9:79018531-79018553 TAGCTATGAAACCAGAGTGCTGG + Intergenic
1057225028 9:93288675-93288697 TGGCCATGGCCCCAGCGTGCTGG - Intronic
1057500429 9:95593558-95593580 TGGCCAGGGAGGCAGAAGGCAGG + Intergenic
1059958704 9:119544597-119544619 TGGCCAGGGCAGAAGAGAGCAGG - Intergenic
1060495936 9:124118600-124118622 TGGCCAGGAGATCAGAGGGCAGG + Intergenic
1061204726 9:129156334-129156356 TGGCCAGGCCACCACAGTCCGGG - Intergenic
1061544859 9:131298768-131298790 TGGCCAGGGAACCAGAGTGCTGG - Intronic
1062240207 9:135533575-135533597 TGGCCAAGGAATCAGAATGTGGG - Intergenic
1192022448 X:67408743-67408765 TGGCCAGCCACTCAGAGTGCGGG - Intergenic
1192584014 X:72306282-72306304 TGGCAAGCGAACCCGAGCGCTGG + Intronic
1195571741 X:106404427-106404449 TGACCAGGGACCAGGAGTGCAGG - Intergenic
1199248329 X:145631831-145631853 TGGCCAGGGAGCAAGGCTGCTGG + Intergenic
1200047533 X:153410697-153410719 TGGCCTTTGAACCAGAGTTCAGG - Intergenic