ID: 1061545432

View in Genome Browser
Species Human (GRCh38)
Location 9:131301645-131301667
Sequence CTCCCACAGCTTCCCGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061545421_1061545432 10 Left 1061545421 9:131301612-131301634 CCTGCACGGTGCCCCAGCCTCCA 0: 1
1: 0
2: 1
3: 23
4: 275
Right 1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG No data
1061545427_1061545432 -10 Left 1061545427 9:131301632-131301654 CCAGGACCAGAGCCTCCCACAGC 0: 1
1: 0
2: 2
3: 28
4: 419
Right 1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG No data
1061545423_1061545432 -1 Left 1061545423 9:131301623-131301645 CCCCAGCCTCCAGGACCAGAGCC 0: 1
1: 1
2: 8
3: 70
4: 652
Right 1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG No data
1061545424_1061545432 -2 Left 1061545424 9:131301624-131301646 CCCAGCCTCCAGGACCAGAGCCT 0: 1
1: 0
2: 3
3: 43
4: 406
Right 1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG No data
1061545425_1061545432 -3 Left 1061545425 9:131301625-131301647 CCAGCCTCCAGGACCAGAGCCTC 0: 1
1: 2
2: 13
3: 62
4: 421
Right 1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG No data
1061545426_1061545432 -7 Left 1061545426 9:131301629-131301651 CCTCCAGGACCAGAGCCTCCCAC 0: 1
1: 0
2: 5
3: 44
4: 403
Right 1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG No data
1061545419_1061545432 24 Left 1061545419 9:131301598-131301620 CCTTCGCTGGTGTTCCTGCACGG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061545432 Original CRISPR CTCCCACAGCTTCCCGGGCC AGG Intronic
No off target data available for this crispr