ID: 1061546767

View in Genome Browser
Species Human (GRCh38)
Location 9:131309078-131309100
Sequence GACTCTCCTCTGGGGAGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061546761_1061546767 -8 Left 1061546761 9:131309063-131309085 CCTGGGGTGTGAGCTGACTCTCC 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1061546767 9:131309078-131309100 GACTCTCCTCTGGGGAGGCCGGG 0: 1
1: 0
2: 4
3: 25
4: 299
1061546759_1061546767 8 Left 1061546759 9:131309047-131309069 CCAGAGAGCTAAAGGGCCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1061546767 9:131309078-131309100 GACTCTCCTCTGGGGAGGCCGGG 0: 1
1: 0
2: 4
3: 25
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061546767 Original CRISPR GACTCTCCTCTGGGGAGGCC GGG Exonic
900030688 1:370368-370390 CACTCTCCCGTGGGGAGACCTGG - Intergenic
900051305 1:599043-599065 CACTCTCCCGTGGGGAGACCTGG - Intergenic
900100424 1:960042-960064 TGCTCTCCTCCGGGGAGCCCCGG - Intergenic
900313803 1:2047460-2047482 GACCCGCCTCTGGGCAGGCAGGG - Intergenic
900401030 1:2472971-2472993 GCCTCTCCCCTGGGGAAGGCTGG - Intronic
901628876 1:10638735-10638757 GGCCCTGCTCTAGGGAGGCCGGG - Exonic
901640446 1:10690495-10690517 GCCTCAACTGTGGGGAGGCCAGG - Intronic
901816249 1:11795061-11795083 GACCCTCCTCTGGGGATCTCTGG + Intronic
902106271 1:14038629-14038651 GACTCTCTTCAGTGGAGCCCAGG - Intergenic
903059204 1:20657822-20657844 TACTCTCCTTTGGAGAGGCCAGG + Intronic
903774595 1:25784746-25784768 GACACTCAACTGGGGTGGCCAGG - Exonic
904852047 1:33466823-33466845 GCCCCTCCTCTGGGGATGCCTGG + Intergenic
904975445 1:34452558-34452580 AACTCTCCTCTGGGGAGAAATGG + Intergenic
907461251 1:54607118-54607140 CACGCTCCTGTGGGGAGGCCGGG - Exonic
907518084 1:55006045-55006067 GACTCTGCACTCAGGAGGCCGGG + Intronic
908064808 1:60391299-60391321 CACTCTCCACAGGGCAGGCCAGG - Intergenic
909730993 1:78889167-78889189 GACTCCCTTCTGGAGATGCCAGG + Intergenic
910289666 1:85588136-85588158 GATTCTCCTCTGGCTAGGACAGG - Intergenic
911427716 1:97741329-97741351 GACTCTCCTCTCCGGGGGACTGG + Intronic
912362264 1:109104596-109104618 GACTCTCCCCTGGGAAGACTGGG + Intergenic
913700791 1:121372574-121372596 GACTCTCCTCTGGATAGGACTGG - Intronic
914041340 1:144053036-144053058 GACTCTCCTCTGGATAGGACTGG - Intergenic
914136744 1:144907450-144907472 GACTCTCCTCTGGATAGGACTGG + Intronic
914863487 1:151405983-151406005 GATTCTCCCCCTGGGAGGCCTGG + Exonic
915588362 1:156857363-156857385 GACTCCCATCAGGGGAGCCCTGG - Intronic
915595734 1:156895394-156895416 GCCTCTCCTCTGAGGAGCCTTGG + Intronic
915788774 1:158644876-158644898 GACTCTACTCTGTGGAGGCTCGG - Intronic
918109589 1:181443728-181443750 GTCTCTCCAATGGTGAGGCCAGG + Intronic
919008317 1:191928347-191928369 GATTCTCCTCTGGCTAGGGCTGG - Intergenic
920488210 1:206391307-206391329 GACTCTCCTCTGGATAGGACTGG - Intronic
920549476 1:206846494-206846516 GACTCCCCTCTGGGTAGGGCTGG - Intergenic
922289925 1:224201524-224201546 TATTCTTCTCTGGGGAGGGCTGG + Intergenic
922572644 1:226643040-226643062 GGCTCACCTATGAGGAGGCCTGG - Intronic
922800100 1:228361268-228361290 GCCTCTCCACTGGGCAGCCCTGG + Intronic
923033641 1:230268814-230268836 GACTCTCTACTGGGCAGGACCGG - Intronic
1063565498 10:7170023-7170045 GCTTCTGCTCTGGGCAGGCCAGG + Intronic
1063712153 10:8490115-8490137 TACCCTCATCTGGGGAGGCAGGG - Intergenic
1064733793 10:18359996-18360018 GACTCTATACTGGGGAGGGCGGG + Intronic
1067089104 10:43257601-43257623 CACTACCCCCTGGGGAGGCCCGG - Intronic
1067151952 10:43743178-43743200 GACTATCCTCAAGGGAGGCCTGG - Intergenic
1069080475 10:64083356-64083378 GACTCTCCATAGGGCAGGCCTGG - Intergenic
1069554849 10:69391053-69391075 GACTCTGCTCTAGGGAGTTCAGG + Intronic
1070684793 10:78472469-78472491 GTCTACCCTGTGGGGAGGCCTGG - Intergenic
1070782777 10:79147182-79147204 GAATCTGGTATGGGGAGGCCTGG + Intronic
1071109356 10:82136760-82136782 GACTCCCCTCTGGCTAGGGCTGG + Intronic
1071873953 10:89823679-89823701 GACTCAGCTGTGGGGAGGCTGGG + Intergenic
1072432966 10:95389870-95389892 GACTCTCCCCTGGGCAGTACTGG + Intronic
1073440482 10:103549721-103549743 GACTAGGGTCTGGGGAGGCCAGG - Intronic
1073571114 10:104581808-104581830 GGCTCCCACCTGGGGAGGCCTGG + Intergenic
1074227008 10:111494384-111494406 GATTCCCCTCTGGGTAGGGCTGG + Intergenic
1076408212 10:130227385-130227407 GACCCTCCACTGGAGAGGCAGGG + Intergenic
1077155895 11:1090654-1090676 GATGCCCCTCTGGGAAGGCCGGG - Intergenic
1077786520 11:5390115-5390137 GCTGCTCCTCTTGGGAGGCCAGG - Exonic
1078100868 11:8329534-8329556 GCCTCTCCCCTGGGGAGGGTTGG + Intergenic
1078511422 11:11987135-11987157 GACTGAACTCTGGGGAGGCAGGG - Intronic
1079352964 11:19708516-19708538 GACTGTCTTCTTGGGAGGTCAGG + Intronic
1079516917 11:21280644-21280666 GATTCTCCTCTGGCTAGGGCTGG - Intronic
1081659305 11:44878179-44878201 CAGTCTAATCTGGGGAGGCCTGG - Intronic
1081911043 11:46700309-46700331 GACTCTGCCCTGGGGAAGGCAGG + Intronic
1083278642 11:61611681-61611703 GACTCTCGTCAGGGGTGGCTTGG + Intergenic
1083689935 11:64401392-64401414 GTCTCTGCTCTTGGCAGGCCGGG - Intergenic
1084560970 11:69905177-69905199 CAGTGTCCTCTGGGCAGGCCTGG + Intergenic
1084582015 11:70029975-70029997 CACTCCCCTCTGGGGAAGGCAGG + Intergenic
1084666428 11:70578898-70578920 GCCCATCCTGTGGGGAGGCCAGG - Intronic
1085463431 11:76708803-76708825 TAATCTCCTCTGAGGAGGGCCGG + Intergenic
1085709911 11:78819911-78819933 CATCCTCCTCTGGGGAAGCCAGG - Intronic
1089086461 11:115821815-115821837 GACTCTCCTCTGGGTAGCAATGG - Intergenic
1089093532 11:115898780-115898802 CACTCTCCTCCTGGCAGGCCAGG + Intergenic
1091493027 12:949396-949418 TACCCACCTCTCGGGAGGCCCGG + Intronic
1091621489 12:2092551-2092573 GACTCTCCTCTGGAGCAGGCTGG + Intronic
1091888164 12:4031652-4031674 GCCTCTCCTCCGGGGAGACGGGG - Intergenic
1092104999 12:5914971-5914993 GACACAGCTCTGGGGAGGTCTGG - Intronic
1095405606 12:41863813-41863835 GATTCTCCTTTGGGGAGGAGGGG - Intergenic
1095640680 12:44482045-44482067 GATTCTCCTCTGGCTAGGGCTGG + Intergenic
1096491780 12:52016607-52016629 GACTCTCATCCTGGGAGGCCGGG - Intergenic
1096693778 12:53336175-53336197 GTCTCTCCTCTCTGGAGGTCTGG + Exonic
1098284257 12:68892296-68892318 GTCTCCCCTCTGGGGAGAACTGG + Intronic
1103316752 12:120062425-120062447 GCCTCCCCTAGGGGGAGGCCTGG - Intronic
1104930813 12:132338583-132338605 AGGTCTCCTCTGGGGAGGGCCGG - Intergenic
1104938400 12:132379788-132379810 GACTCTGCTCGGGGGTGTCCTGG - Intergenic
1104938411 12:132379828-132379850 GACTCTGCTCGGGGGCGTCCTGG - Intergenic
1104938422 12:132379867-132379889 GACTCTGCTCGGGGGCGTCCTGG - Intergenic
1104938432 12:132379907-132379929 GACTCTGCTCGGGGGCGTCCTGG - Intergenic
1105443267 13:20432585-20432607 AACTCTGTCCTGGGGAGGCCAGG - Intronic
1108857942 13:54819383-54819405 GATTCCCCTCTGGTGAGGGCTGG - Intergenic
1112578989 13:100662333-100662355 GCATCTCCTCAGTGGAGGCCTGG + Intronic
1112805769 13:103162529-103162551 GAGTGCCCTCTGGGGAGGCAGGG - Intergenic
1114432092 14:22670531-22670553 GATTCTCCTCTGGCAAGGGCTGG - Intergenic
1114783836 14:25570841-25570863 GACTCTCCTCTGGCTAGGGCTGG + Intergenic
1114925755 14:27395690-27395712 GACTCCCTTTTGGGGAGGTCAGG + Intergenic
1116872876 14:50084428-50084450 AACTCTCACCTGGGAAGGCCTGG - Intronic
1119481751 14:74962346-74962368 CCCACTCCACTGGGGAGGCCTGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1123024400 14:105417895-105417917 TCCTCTCCGCTGGGGAGGCCTGG + Intronic
1123467743 15:20528989-20529011 GAATCCCCTCTGGAGAGCCCGGG + Intergenic
1123650370 15:22472053-22472075 GAATCCCCTCTGGAGAGCCCGGG - Intergenic
1123728056 15:23124198-23124220 GAATCCCCTCTGGAGAGCCCGGG + Intergenic
1123740778 15:23280895-23280917 GAATCCCCTCTGGAGAGCCCGGG - Intergenic
1123746220 15:23321663-23321685 GAATCCCCTCTGGAGAGCCCGGG + Intergenic
1124278487 15:28344980-28345002 GAATCCCCTCTGGAGAGCCCGGG + Intergenic
1124304213 15:28566628-28566650 GAATCCCCTCTGGAGAGCCCGGG - Intergenic
1124533089 15:30523096-30523118 GAATCCCCTCTGGAGAGCCCGGG - Intergenic
1124765567 15:32484548-32484570 GAATCCCCTCTGGAGAGCCCGGG + Intergenic
1125277103 15:38004577-38004599 GATTCTCCTCTGGCTAGGGCTGG + Intergenic
1127846855 15:62877801-62877823 GACAGACATCTGGGGAGGCCCGG + Intergenic
1129826428 15:78637835-78637857 GACCCCCCTCTGGAGAGCCCAGG - Intronic
1130512506 15:84601120-84601142 GGCTCACCTCTCGGGAGACCAGG - Exonic
1132025450 15:98401104-98401126 GCCTCTCCTCGGGAGAGGTCTGG - Intergenic
1132372551 15:101308640-101308662 TCCTTTCCTCTGGGGCGGCCTGG - Intronic
1132678608 16:1130791-1130813 GAGGCTCCCCTGGGTAGGCCGGG + Intergenic
1132746512 16:1438502-1438524 CACTCTGCTCGGGGGAGGCAAGG + Intronic
1132974946 16:2706552-2706574 GCCTGTCCTCAGGGGAGCCCAGG + Intronic
1134407144 16:13970473-13970495 GACTCCCCTCTGGCTAGGGCTGG + Intergenic
1135265768 16:21024333-21024355 GATTCTCCACTGGGGAGCCAGGG + Intronic
1138008431 16:53357675-53357697 GAATCCCCTCTGGAGAGCCCGGG + Intergenic
1138269520 16:55685126-55685148 CCCTCTCCTCTGGGCAGGCGTGG + Exonic
1138609917 16:58114782-58114804 GACCTTCCTCTGGGGAAGACTGG + Intronic
1140125059 16:72111859-72111881 GCCTCACCTCTGGGGAGGAGGGG - Intronic
1142063735 16:88047979-88048001 GGCTGTCCCCTGGGGAGGGCAGG + Intronic
1142122948 16:88396331-88396353 GACCCTCCTGCAGGGAGGCCTGG + Intergenic
1142122991 16:88396466-88396488 GACCCTCCTGAAGGGAGGCCGGG + Intergenic
1142123026 16:88396574-88396596 GACCCTCCTGAAGGGAGGCCGGG + Intergenic
1142123045 16:88396628-88396650 GACCCTCCTGAAGGGAGGCCGGG + Intergenic
1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG + Intergenic
1142123112 16:88396844-88396866 GACCCTCCTGAAGGGAGGCCGGG + Intergenic
1142123157 16:88396979-88397001 GACCCTCCTGAAGGGAGGCCGGG + Intergenic
1142123167 16:88397006-88397028 GACCCTCCTGAAGGGAGGCCGGG + Intergenic
1142593208 17:1016701-1016723 GCCTCTCCTCTGCAGAGGACAGG + Intronic
1144439806 17:15271510-15271532 GACTGTCCCCTGGGGAGGATGGG - Intergenic
1145963579 17:28901610-28901632 CACTCTCCTGTGGAGAGGCAAGG + Exonic
1146128118 17:30245171-30245193 GACTGGCCTCTGGGAAGTCCTGG - Intergenic
1146970049 17:37065263-37065285 CTTTCTCCTGTGGGGAGGCCTGG + Intergenic
1147627040 17:41906996-41907018 CGGTCTCGTCTGGGGAGGCCTGG - Intronic
1148165525 17:45481734-45481756 GACTCTCCTGTGGCCAGGACGGG + Intronic
1149110041 17:53018015-53018037 GACTGTACCCTGGGAAGGCCAGG + Intergenic
1150248236 17:63691687-63691709 GAGTCCCCTCAGGGGAGGGCTGG - Intronic
1150396752 17:64828450-64828472 GACTCTCCTGTGGCCAGGACGGG + Intergenic
1150694474 17:67392666-67392688 GACTCTCCCCTGGGGAATCTAGG - Intronic
1151371445 17:73648668-73648690 GTCTCTACTCTGGGGGGCCCTGG - Intergenic
1151868307 17:76819726-76819748 GGCTCTGCTCCGGGGATGCCTGG + Intergenic
1151897783 17:76991897-76991919 GGCTCGGCTCTGGGGTGGCCAGG + Intergenic
1152073136 17:78143945-78143967 GACTCTGCTCTGGGCTGCCCTGG - Intergenic
1152396430 17:80036075-80036097 GCCTTTCCTTTGGGGACGCCAGG - Intergenic
1152629894 17:81406195-81406217 GACCCTCCCCTGGACAGGCCAGG - Intronic
1152638786 17:81440947-81440969 GCCTCTCCTCTGGGGGCGCCAGG + Intronic
1152948925 17:83215037-83215059 CACTCTCCCGTGGGGAGACCTGG + Intergenic
1153362117 18:4209017-4209039 AACTGTCCTCAGGTGAGGCCGGG + Intronic
1155792769 18:29995583-29995605 GACTCCCCTCTGGCTAGGGCTGG - Intergenic
1155836570 18:30593223-30593245 GACTATCCTCTGAGATGGCCAGG - Intergenic
1158523087 18:58188165-58188187 GACCGTCCTGTGGGGTGGCCTGG - Intronic
1160749418 19:726992-727014 GCTTCTCCTGTGGGGAGGGCCGG - Exonic
1161159986 19:2756607-2756629 GAAACACCTCTGGGGAGGCCCGG + Intronic
1161433711 19:4249382-4249404 GAGTCACCTCTGTGGATGCCAGG - Intronic
1162957594 19:14107779-14107801 GCCCCTTCTCTGGGGAGGCCGGG + Intronic
1164521900 19:28985954-28985976 GACCCTCCTCTGCTGAGGGCAGG + Intergenic
1164598292 19:29544719-29544741 GAGTTCCCTCTGGGGAGCCCAGG - Intronic
1165121398 19:33561131-33561153 GGGCCTCCTTTGGGGAGGCCAGG + Intergenic
1165123513 19:33578640-33578662 GCTTCTCCTCTGGGGAGAGCTGG + Intergenic
1167215455 19:48161445-48161467 GACTCTCCGGTGAAGAGGCCAGG - Exonic
1167779628 19:51590727-51590749 GAGTCTCACCTGGGGAGTCCAGG + Exonic
1168289786 19:55352010-55352032 GACACGGCTCTGGGGAGGTCAGG + Intronic
925249824 2:2422574-2422596 GACTCCCCTCTGGCTAGGGCTGG + Intergenic
925405854 2:3605265-3605287 GACTCCCCTCAGCGGCGGCCTGG - Intronic
925754254 2:7118824-7118846 GACTCTGCTCTAAGGATGCCTGG + Intergenic
927510840 2:23642835-23642857 GACTTACCTCTGGGGTGCCCCGG - Exonic
927683625 2:25156017-25156039 GTTTCTCCTCAGGGGAGGGCAGG + Exonic
927787243 2:25982361-25982383 GCCTCTGCCCTCGGGAGGCCCGG - Exonic
928244544 2:29615967-29615989 GCATCTCCTCTGCAGAGGCCAGG + Intronic
928389453 2:30897923-30897945 GACTCCCCTGTGGGGTTGCCTGG - Intergenic
931436707 2:62253896-62253918 GACTCTTCTTTGGCCAGGCCTGG - Intergenic
932106114 2:68944235-68944257 CACACTCCTGTGGGGTGGCCAGG + Intergenic
932614153 2:73221339-73221361 AGCTCTCCTTTGGGAAGGCCAGG - Intronic
933919092 2:87026716-87026738 GTCTCTCCTCTGGGGAGTCCTGG - Intergenic
934003902 2:87743191-87743213 GTCTCTCCTCTGGGGAGTCCTGG + Intergenic
934563652 2:95326646-95326668 GCCTGTCCTCTGGGGAGACCGGG - Intronic
934606499 2:95699320-95699342 GCAGCTCCTCAGGGGAGGCCAGG + Intergenic
935251494 2:101265834-101265856 GACTCTCCTCAGGAAAGGCAAGG + Intronic
935719830 2:105970402-105970424 GACTCTCCTCTGGGGCGTGGTGG - Intergenic
936109987 2:109657144-109657166 GACTCTGCTCTGTGGGGGACAGG + Intergenic
936484751 2:112916377-112916399 GACCCTACTCTAGGCAGGCCTGG + Intronic
937027043 2:118707549-118707571 GACTCCCCTCTGGGTAGCCAGGG + Intergenic
937236772 2:120436007-120436029 GCCTGGCCTCTGGGGATGCCTGG - Intergenic
937628255 2:124068408-124068430 AATTCTCCTCTGGCTAGGCCTGG - Intronic
937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG + Intergenic
938453874 2:131445682-131445704 TGCTCTCCTCTGGGGAGCCACGG - Intergenic
942603734 2:177668033-177668055 CCATCTCCTCAGGGGAGGCCTGG - Intronic
945931627 2:215861027-215861049 GACTGTCATGTGAGGAGGCCTGG + Intergenic
946018230 2:216621156-216621178 GATTCTCCTCTGGGGACACTGGG + Intergenic
946209163 2:218133632-218133654 GATCCTGCTCTGGGGAAGCCTGG - Intronic
946780263 2:223187691-223187713 TTCTCTCCTCTGAGGAGGCAAGG - Intronic
947118761 2:226796980-226797002 GACCCTCCTCTGGGTAGGAGCGG + Exonic
947337801 2:229105302-229105324 GAATCTCCCCTGGGGAGGATGGG - Intronic
948673108 2:239581337-239581359 GACTTGGCCCTGGGGAGGCCTGG - Intronic
948856700 2:240733576-240733598 GACTCTGCCCAGGGGTGGCCGGG - Intronic
1169334093 20:4740823-4740845 CGCTCTCCTCAGGGAAGGCCAGG - Intergenic
1170445735 20:16425634-16425656 AACTCCCCAGTGGGGAGGCCTGG + Intronic
1170709356 20:18776015-18776037 GATTCTCCTCTGGCTAGGGCTGG + Intergenic
1173647676 20:44643690-44643712 GATTCCCCTCTGGAGAGGTCAGG - Intronic
1175516540 20:59574026-59574048 GAACCTCCTCTGCTGAGGCCTGG - Intergenic
1175664165 20:60844021-60844043 GTCTCTCCACTGGGGAGACAGGG + Intergenic
1175737167 20:61395059-61395081 CACTCTCCTCCTGGGAGGACAGG + Intronic
1175839083 20:62015210-62015232 AACCCTCCTCTCGGGAGGCAGGG + Intronic
1175962182 20:62642708-62642730 GCCTCTCCGCGGGGGAGGGCAGG + Intronic
1176090991 20:63318597-63318619 GACTCCCCTGTGGGGTGTCCTGG + Intronic
1179899794 21:44384335-44384357 GACCATCCTCTGGGAAGGCAAGG - Intronic
1180937364 22:19634519-19634541 GCCCCTCCTCTGGGAAGCCCGGG - Intergenic
1181462563 22:23094302-23094324 GCCCCTCGTGTGGGGAGGCCTGG + Intronic
1182124138 22:27804209-27804231 GCCTGTCGTCTGGGGAGACCCGG + Intergenic
1183692942 22:39401285-39401307 CAATCCCCACTGGGGAGGCCTGG - Intronic
1185021167 22:48377043-48377065 CTGTCTCCTCTGGGGAGGGCAGG + Intergenic
1185068044 22:48641726-48641748 GACTTTCCGCTGGGTTGGCCTGG - Intronic
1185275072 22:49947250-49947272 GACACAGCTCTGGGGAGGCAAGG - Intergenic
951417714 3:22445505-22445527 GGCTTTGATCTGGGGAGGCCTGG + Intergenic
953026931 3:39150904-39150926 GATACTCCTCTGGAGAGGCGGGG + Intronic
954293584 3:49662342-49662364 GGCTCTCCTCTTCAGAGGCCTGG - Exonic
954460681 3:50625246-50625268 GGCTCTCATTTGGGGTGGCCTGG + Intronic
954640190 3:52093212-52093234 CCAGCTCCTCTGGGGAGGCCTGG + Intronic
954707650 3:52489558-52489580 GATTCTCCTCCGAGGTGGCCTGG - Exonic
955639272 3:61064831-61064853 GACTCTCCTTTGGGGAGTCAAGG - Intronic
955950620 3:64239108-64239130 CACCCTCCTCTGAGGGGGCCAGG + Intronic
955961221 3:64343176-64343198 GACTGTACTCTGTGGAAGCCTGG - Intronic
957085839 3:75675624-75675646 GATTCTCCTCTGGCTAGGGCTGG + Intergenic
958878112 3:99638463-99638485 CACTCTTCTCTGGGGAGGGGCGG - Exonic
960975180 3:123166694-123166716 GAGCCTCCTCTGGGCAGGGCTGG + Intronic
961105564 3:124238039-124238061 CACTCTCCTCTCTGTAGGCCAGG + Intronic
962974286 3:140432724-140432746 GACTCTCCTGTGGATAAGCCTGG + Intronic
963288570 3:143463244-143463266 CATTCTCATCTGGGGAGCCCGGG + Intronic
963331348 3:143919535-143919557 GGGTCTGCTCTGGGGAGCCCAGG + Intergenic
963572012 3:147009240-147009262 GATTCCCCTCTGAGTAGGCCTGG + Intergenic
964337018 3:155665669-155665691 AGCTCTGCTCTGGTGAGGCCGGG - Intronic
964450591 3:156809352-156809374 GACTCTGGTCTTGGGAGGCGAGG - Intergenic
964661188 3:159122073-159122095 GACTCTCTTCTGGGTTGGGCAGG + Intronic
964880052 3:161413286-161413308 GACTTTCCTGGAGGGAGGCCAGG + Intergenic
965867121 3:173217490-173217512 GACTCCCCTCTGGCTAGGGCTGG + Intergenic
969722411 4:8899754-8899776 CACTCTCCTCTGGAGAAGCGGGG + Intergenic
971149083 4:24012058-24012080 GGCGCTCCTATGAGGAGGCCGGG - Intergenic
971220864 4:24704931-24704953 GTGCCTCCTCTGGGGAGGACCGG + Intergenic
975095431 4:70451138-70451160 GATTCTCCTCTGGCTAGGGCTGG + Intronic
983471137 4:168156860-168156882 GAGTCTCCTGTTTGGAGGCCAGG - Intronic
985653645 5:1118966-1118988 AACATTCCTCTGGGGAGGTCTGG - Intergenic
986029818 5:3883516-3883538 GGCTCTCTTCTGAGGTGGCCAGG - Intergenic
986070822 5:4280646-4280668 GACTCTTATCTGGGGAGAACAGG - Intergenic
988578038 5:32444956-32444978 GCCTGTCCTCTGGGGAGTCGGGG + Intergenic
989440864 5:41471470-41471492 GATTCTCCTCTGGCTAGGACTGG - Intronic
992376567 5:76193656-76193678 GCCTCTCCACTGGGAAGTCCTGG - Intronic
992627593 5:78648968-78648990 GACACTCCCCTCCGGAGGCCGGG - Intronic
995298150 5:110543296-110543318 GATTCTCTTGTGGGGAGCCCAGG + Intronic
997523803 5:134539893-134539915 GACTCTCCCCTGGGGAGGTGGGG + Intronic
997745527 5:136296902-136296924 GACTCCTGGCTGGGGAGGCCAGG - Intronic
997907702 5:137835824-137835846 GACTCTGCCCTGGGGAGGCCAGG + Intergenic
998539891 5:142970676-142970698 GACTGTCATCTGGGGAGGAATGG + Intronic
1002298723 5:178245958-178245980 GTCTCTCCTCAGGGCAGACCCGG - Exonic
1002743132 5:181448500-181448522 CACTCTCCCGTGGGGAGACCTGG + Intergenic
1004550855 6:16645893-16645915 ACCACTCCTCTGGGGAGCCCAGG + Intronic
1011340902 6:86313319-86313341 GATTCTCCTCTGGCTAGGGCTGG - Intergenic
1012189128 6:96259824-96259846 GATTCTCCTCTGGCTAGGGCTGG - Intergenic
1013688838 6:112616505-112616527 GACTCTGGTCTTGGGAGGCGAGG - Intergenic
1013723665 6:113064636-113064658 GACTCTGCTCTGGTTAGGCAAGG - Intergenic
1014100965 6:117511220-117511242 GATACTCCTGTGGAGAGGCCTGG - Intronic
1016153882 6:140780262-140780284 GACTCCCCTCTGGCTAGGGCTGG - Intergenic
1016541389 6:145170080-145170102 GATTCTCCTCTGGCTAGGGCTGG - Intergenic
1018109790 6:160524028-160524050 GGCTCTGCTCTGGTGTGGCCTGG + Intergenic
1018127689 6:160697352-160697374 GTCTCTCCTCTGGGGAGTCCTGG + Intergenic
1018148811 6:160919690-160919712 GTTTCTCCTCTGGTGAGTCCTGG - Intergenic
1018657692 6:166055210-166055232 GCCCATCCTCTGGGGAGCCCTGG + Intergenic
1019248232 6:170723913-170723935 CACTCTCCCGTGGGGAGACCTGG + Intergenic
1019373543 7:676590-676612 GTCCCTGCTCTGGGAAGGCCCGG - Intronic
1019510337 7:1414500-1414522 GACTCTGCTGTGTGCAGGCCGGG - Intergenic
1019558985 7:1646609-1646631 GACCCTCCTCCAGGGAAGCCAGG + Intergenic
1019640106 7:2098810-2098832 GGCCCACCTCTGGGGACGCCGGG - Intronic
1021842559 7:24732722-24732744 GATTCTCCTCTGGCTAGGGCTGG - Intronic
1021968331 7:25944005-25944027 TTCTCTCCTCCAGGGAGGCCAGG - Intergenic
1023004878 7:35853414-35853436 GACTCTCCTCGGGGCTGGGCGGG + Intronic
1023038683 7:36153955-36153977 GATTCTCCTCTAGGGACGTCCGG - Intronic
1024064346 7:45720092-45720114 GACACTCAGCTGGGAAGGCCTGG - Exonic
1024231387 7:47366610-47366632 GACTCAGGTCTGGGGTGGCCTGG - Intronic
1026566809 7:71496215-71496237 GACCCTGCAGTGGGGAGGCCGGG + Intronic
1026639222 7:72109769-72109791 GACTCTCACGTCGGGAGGCCTGG - Intronic
1026644008 7:72152255-72152277 GCCTCCCCTATGGGGAGACCAGG + Intronic
1029599851 7:101557374-101557396 AACCTCCCTCTGGGGAGGCCAGG - Exonic
1030391387 7:108932098-108932120 AATTCTCCTCTGGGTAGGGCTGG + Intergenic
1032264917 7:130363964-130363986 ATCTGCCCTCTGGGGAGGCCAGG + Intronic
1033691223 7:143739728-143739750 GATTCTCCTCTGGCTAGGCCTGG - Intergenic
1034082503 7:148292656-148292678 GACTCTTCACTGGGGAGGTTGGG + Intronic
1034684265 7:152956199-152956221 GCCACTCCTCTGGGGGCGCCGGG + Intergenic
1035499870 8:83800-83822 CACTCTCCCGTGGGGAGACCTGG - Intergenic
1036201441 8:6774190-6774212 GCCTGTCTTCTGGGGAGGCCGGG + Intergenic
1036585374 8:10118692-10118714 TTCTCTCCTCTGAGGACGCCTGG + Intronic
1036686317 8:10913990-10914012 GACTCTCCTTTGGTCAGGTCCGG + Intronic
1036808660 8:11852603-11852625 CACTCACCTCTGGGGTGGCTTGG + Exonic
1037807971 8:22069045-22069067 GACTCACCTCTGGGGATGGTGGG - Exonic
1038482202 8:27909560-27909582 GGCACTCCCCTGGGGAGCCCTGG + Intronic
1038804873 8:30781206-30781228 GATTCTCCTCTGGAGTAGCCGGG - Intronic
1040862406 8:52013159-52013181 CACTGTTCTCTGGGAAGGCCTGG - Intergenic
1042726966 8:71889078-71889100 GACTCCCCTCTGGCTAGGGCTGG + Intronic
1043340359 8:79230180-79230202 GACTCCCCTCTGGCTAGGACTGG + Intergenic
1044026261 8:87175908-87175930 GATTCTCCTCTGGCTAGGGCGGG + Intronic
1044726976 8:95201998-95202020 CACTCTCCCATGGGGAGGGCAGG + Intergenic
1045061641 8:98416524-98416546 CACACTCCACTGGGCAGGCCTGG + Intronic
1046211467 8:111081581-111081603 GATTCCCCTCTGGGTAGGGCTGG + Intergenic
1049715231 8:144086664-144086686 GACTCAACTCTGAGGAAGCCAGG - Intergenic
1050544110 9:6695162-6695184 GAATTTCCTCTGAGGATGCCAGG - Intergenic
1054742558 9:68822934-68822956 GACTCTCCCCTGGAGTGTCCAGG - Intronic
1056556684 9:87695393-87695415 CACTGGCCTCTGGGGCGGCCTGG - Intronic
1056767064 9:89450927-89450949 GACTCTGGTCTTGGGAGGCGAGG + Intronic
1059334304 9:113559163-113559185 GACTCAGCTACGGGGAGGCCAGG - Intronic
1059964651 9:119601810-119601832 CTCTCTCCTCTGGGCAGCCCAGG + Intergenic
1060186294 9:121566149-121566171 GACCCTCCTCCAGGCAGGCCTGG + Intergenic
1061546767 9:131309078-131309100 GACTCTCCTCTGGGGAGGCCGGG + Exonic
1061568535 9:131460918-131460940 AACTGTCCGCTGAGGAGGCCCGG - Intronic
1061779959 9:132989642-132989664 GACACTCCATTGGGGCGGCCTGG - Intronic
1061782642 9:133004850-133004872 GGGCCTCCTCTGGGGAGGCCTGG + Intergenic
1203609013 Un_KI270748v1:79535-79557 CACTCTCCCGTGGGGAGACCTGG + Intergenic
1185831847 X:3310367-3310389 GTCTCTCCTCGGTGGACGCCGGG - Exonic
1188366580 X:29323061-29323083 GACTCTCCTCTGAGAAAGCCAGG - Intronic
1189306209 X:39988607-39988629 GGCTTTCATCTGGAGAGGCCTGG + Intergenic
1190279921 X:48922827-48922849 CTCTCTCCTCTGGGGCTGCCTGG + Exonic
1192554574 X:72079696-72079718 GCCTCTCCTCTGGGAAGGAAGGG + Intergenic
1196270167 X:113700338-113700360 GACTCCCCTCTGGTTAGGTCTGG + Intergenic
1196950081 X:120868411-120868433 GACTCTGGTCTTGGGAGGCAAGG - Intergenic
1197661638 X:129179647-129179669 GATTCTCCTCTGGCTAGGGCTGG + Intergenic
1198205452 X:134460540-134460562 GTCCCTCCTCGGGGGAGCCCTGG + Intronic
1198583689 X:138096185-138096207 GCCCCGCCACTGGGGAGGCCAGG - Intergenic
1199018564 X:142848205-142848227 GATTCTCCTCTGGCTAGGGCTGG + Intergenic
1199041174 X:143116818-143116840 GATTCCCCTCTGGGTAGGGCTGG + Intergenic
1199218013 X:145283025-145283047 GACTCTCCTCTGGCTAGAGCTGG + Intergenic
1200174708 X:154105542-154105564 GACTCTTCTCTGTGTAGGACAGG - Intergenic
1200247848 X:154535367-154535389 GCTTCTCCTCTGGGGTGGCCTGG + Exonic
1201244156 Y:11986713-11986735 GTCTCTCCTCGGTGGACGCCGGG + Intergenic