ID: 1061546870

View in Genome Browser
Species Human (GRCh38)
Location 9:131309533-131309555
Sequence GTCCATCAGCATCACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061546870_1061546874 6 Left 1061546870 9:131309533-131309555 CCCTCACTGTGATGCTGATGGAC No data
Right 1061546874 9:131309562-131309584 CCCTCTCTCACTTCAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061546870 Original CRISPR GTCCATCAGCATCACAGTGA GGG (reversed) Intergenic
No off target data available for this crispr