ID: 1061556963

View in Genome Browser
Species Human (GRCh38)
Location 9:131376600-131376622
Sequence TTGTGTTAACAAGGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061556963_1061556970 3 Left 1061556963 9:131376600-131376622 CCTGTGTTTCCTTGTTAACACAA No data
Right 1061556970 9:131376626-131376648 GAAGTGGGAGTGGAACCAGGAGG No data
1061556963_1061556969 0 Left 1061556963 9:131376600-131376622 CCTGTGTTTCCTTGTTAACACAA No data
Right 1061556969 9:131376623-131376645 CTGGAAGTGGGAGTGGAACCAGG No data
1061556963_1061556968 -7 Left 1061556963 9:131376600-131376622 CCTGTGTTTCCTTGTTAACACAA No data
Right 1061556968 9:131376616-131376638 AACACAACTGGAAGTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061556963 Original CRISPR TTGTGTTAACAAGGAAACAC AGG (reversed) Intergenic
No off target data available for this crispr