ID: 1061559554

View in Genome Browser
Species Human (GRCh38)
Location 9:131393975-131393997
Sequence AGGGGGCGCTGCGCGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061559530_1061559554 25 Left 1061559530 9:131393927-131393949 CCCGGCCCCCGGGCCGATCCCAA No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559544_1061559554 0 Left 1061559544 9:131393952-131393974 CCGCCGCTCCCGGGAGGCGCGGC No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559541_1061559554 6 Left 1061559541 9:131393946-131393968 CCAAGGCCGCCGCTCCCGGGAGG No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559534_1061559554 19 Left 1061559534 9:131393933-131393955 CCCCGGGCCGATCCCAAGGCCGC No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559531_1061559554 24 Left 1061559531 9:131393928-131393950 CCGGCCCCCGGGCCGATCCCAAG No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559529_1061559554 30 Left 1061559529 9:131393922-131393944 CCTCGCCCGGCCCCCGGGCCGAT No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559533_1061559554 20 Left 1061559533 9:131393932-131393954 CCCCCGGGCCGATCCCAAGGCCG No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559545_1061559554 -3 Left 1061559545 9:131393955-131393977 CCGCTCCCGGGAGGCGCGGCAGG No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559550_1061559554 -8 Left 1061559550 9:131393960-131393982 CCCGGGAGGCGCGGCAGGGGGCG No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559540_1061559554 7 Left 1061559540 9:131393945-131393967 CCCAAGGCCGCCGCTCCCGGGAG No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559551_1061559554 -9 Left 1061559551 9:131393961-131393983 CCGGGAGGCGCGGCAGGGGGCGC No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559536_1061559554 17 Left 1061559536 9:131393935-131393957 CCGGGCCGATCCCAAGGCCGCCG No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559535_1061559554 18 Left 1061559535 9:131393934-131393956 CCCGGGCCGATCCCAAGGCCGCC No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data
1061559537_1061559554 12 Left 1061559537 9:131393940-131393962 CCGATCCCAAGGCCGCCGCTCCC No data
Right 1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061559554 Original CRISPR AGGGGGCGCTGCGCGGGCCC AGG Intergenic
No off target data available for this crispr