ID: 1061559993

View in Genome Browser
Species Human (GRCh38)
Location 9:131395688-131395710
Sequence CCAGCACCTGTGGCATCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061559993_1061560000 2 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG No data
Right 1061560000 9:131395713-131395735 TAAGGCATGGACAATACAGAAGG No data
1061559993_1061560001 11 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG No data
Right 1061560001 9:131395722-131395744 GACAATACAGAAGGAATTCAAGG No data
1061559993_1061560002 26 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG No data
Right 1061560002 9:131395737-131395759 ATTCAAGGCCCAAACATTAGTGG No data
1061559993_1061560003 27 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG No data
Right 1061560003 9:131395738-131395760 TTCAAGGCCCAAACATTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061559993 Original CRISPR CCAGCACCTGTGGCATCCAT GGG (reversed) Intronic