ID: 1061559993

View in Genome Browser
Species Human (GRCh38)
Location 9:131395688-131395710
Sequence CCAGCACCTGTGGCATCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061559993_1061560003 27 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1061560003 9:131395738-131395760 TTCAAGGCCCAAACATTAGTGGG No data
1061559993_1061560001 11 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1061560001 9:131395722-131395744 GACAATACAGAAGGAATTCAAGG No data
1061559993_1061560000 2 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1061560000 9:131395713-131395735 TAAGGCATGGACAATACAGAAGG No data
1061559993_1061560002 26 Left 1061559993 9:131395688-131395710 CCCATGGATGCCACAGGTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1061560002 9:131395737-131395759 ATTCAAGGCCCAAACATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061559993 Original CRISPR CCAGCACCTGTGGCATCCAT GGG (reversed) Intronic
900129144 1:1080285-1080307 CCAGGACCTGTGGCAGCGAGGGG - Intergenic
900635365 1:3662204-3662226 CCTGCAGCTGTGGCATCCACAGG + Intronic
900916985 1:5646075-5646097 CCAGCACCTGTCACAGCCATGGG + Intergenic
905107861 1:35574665-35574687 CTGCCACGTGTGGCATCCATGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906198449 1:43944496-43944518 CAAGAACCTGTGGCAACCCTGGG - Intergenic
907963649 1:59307968-59307990 CCAGCATGTGTTGCATCCAGGGG + Intronic
916483614 1:165237137-165237159 TCAGCATCTGTTCCATCCATAGG - Intronic
917145069 1:171881729-171881751 CAAGCACCTTTGGCCTCCAGTGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
919870961 1:201820960-201820982 CCACTATCTTTGGCATCCATGGG + Exonic
921178134 1:212610582-212610604 CCAGCATCTGTGGCAGTGATGGG + Intronic
1064138843 10:12773291-12773313 CCAGCCCCTGTGGATACCATGGG - Intronic
1064339094 10:14470744-14470766 CCAGGGCATGTGGCATCCATGGG - Intergenic
1065877851 10:30012645-30012667 CCAGCACCTTTGGTCTCCACTGG - Intergenic
1067426538 10:46215468-46215490 CCTGCTCCTGTGGCACCCCTTGG + Intergenic
1067504829 10:46840540-46840562 CCAGCTCCTGTGGGACCCCTTGG - Intergenic
1068143873 10:53040711-53040733 CCAGCAGCTGTAGTATCAATAGG + Intergenic
1068755332 10:60646586-60646608 TCAGGGCCTGTGGCATCCCTGGG + Intronic
1070716940 10:78729283-78729305 GAAGCACCTTTGTCATCCATGGG - Intergenic
1070911355 10:80121422-80121444 CCAGCAATTTTGGCATTCATTGG - Intergenic
1072030830 10:91520624-91520646 CCAGTACCTTGGGCATCTATAGG + Intergenic
1072736033 10:97880307-97880329 CCGGCACCTGTAGCTTCCATAGG + Exonic
1073002376 10:100295195-100295217 GCAACTCCTGTGGCCTCCATAGG - Intronic
1074198663 10:111211436-111211458 CCTGCACCTTTGGGATCCCTTGG + Intergenic
1075906123 10:126083446-126083468 CCAGCAGCAGTAGTATCCATGGG + Intronic
1077539598 11:3140331-3140353 CCAGCACCTGAGGGATACAGGGG - Intronic
1078465085 11:11544111-11544133 CCCACACCTATGGCATCCAGGGG - Intronic
1078825522 11:14926444-14926466 CCAGCATCTTTGGCATCCCTTGG - Intronic
1081526082 11:43928651-43928673 CCAGCTCCTGCGTCCTCCATGGG - Intronic
1084665909 11:70576172-70576194 CCAGCACCTGTGACAACAAAGGG - Intronic
1086180416 11:83944524-83944546 ACAGCACCTCTGACTTCCATCGG - Intronic
1086949030 11:92872313-92872335 GCCACACCAGTGGCATCCATTGG - Intronic
1087969011 11:104455822-104455844 CCACCACCTCTGTCATACATTGG + Intergenic
1088725372 11:112629783-112629805 ACAGCAACTGTGGCATTCCTAGG + Intergenic
1088816916 11:113427713-113427735 GCAGCACCTATGGCACCCTTGGG - Intronic
1089667199 11:120027938-120027960 CCTGCACCTGTGGAAGCCCTGGG - Intergenic
1090953732 11:131496570-131496592 CCAGCAGCTCTGGGAGCCATAGG + Intronic
1091261959 11:134241624-134241646 CCAGCAGCTGTGCCACCCGTAGG + Intronic
1094546846 12:31412391-31412413 CCAGCCCCTGCGACAGCCATGGG - Intronic
1095745005 12:45648288-45648310 CCTGCACCTGTGCCATCAACAGG - Intergenic
1096612685 12:52813507-52813529 CCAGCACCTGTGGCAGGCTCAGG + Intronic
1096744138 12:53714554-53714576 TCCTCACCTGTGGCATCCACGGG + Intronic
1100853660 12:98739406-98739428 CCCCCACCTGTCCCATCCATTGG - Intronic
1106020347 13:25908593-25908615 TCAGCAACTGTAGCAGCCATGGG - Intronic
1106343044 13:28849625-28849647 CCAGCACAGATGGCGTCCATGGG - Intronic
1106866026 13:33964969-33964991 CCAACTTCTGTGGCATCCCTTGG - Intronic
1111249506 13:85585549-85585571 CCAGCAGCTGTGGCATCCCCTGG - Intergenic
1113539430 13:111094991-111095013 CCTTCACCTGTGGCCTCCAGTGG - Intergenic
1113815769 13:113169942-113169964 CCAGCCACTGTGGCCTCCCTGGG + Intronic
1113925361 13:113938942-113938964 ACAGCACCTGCGGCCTCCCTGGG + Intergenic
1115371718 14:32623099-32623121 ACTGAACCTGTGGCATCTATAGG - Intronic
1116866998 14:50039391-50039413 ACATCACCTGTGGCCTTCATCGG - Intergenic
1118208054 14:63741690-63741712 CCAGAACCTGTGGCATCTCTAGG - Intergenic
1118457815 14:65960728-65960750 ACAGCATCTGAGGCATCGATGGG - Intronic
1127364179 15:58271956-58271978 CCGGCTCCTGTGGCAGCCAGTGG + Intronic
1127746682 15:61983932-61983954 CCATCACTTGTGGCTTCAATTGG - Exonic
1132684372 16:1156163-1156185 CCAGCACCTCTGGCACGCTTTGG + Intronic
1133204679 16:4226251-4226273 CCTGCACCTAGGGCAGCCATTGG + Intronic
1134221756 16:12360505-12360527 CCACCACCTGTGACATCGTTGGG - Intronic
1137505370 16:49049646-49049668 CCAGCTCCTCTTGCCTCCATGGG - Intergenic
1138339282 16:56278273-56278295 CCAGCACCTGGCCCATCCCTAGG + Intronic
1142111283 16:88332983-88333005 CCAGCCTCTGTGGCACCCAGAGG + Intergenic
1142280094 16:89143475-89143497 TCAGCAGCTGTGGCATCCGTGGG + Intronic
1143663246 17:8340279-8340301 CCAACACCTGGGCCATCCAGCGG - Exonic
1143923082 17:10346418-10346440 CCAGCTCCTCTGGGATTCATGGG - Intronic
1144658019 17:17050519-17050541 CCACCACCTGTGGCACCCCAGGG - Intronic
1146497332 17:33334779-33334801 CCATCACCTGTGGAATACACAGG - Intronic
1147648485 17:42048673-42048695 CCAGAACCTGCTCCATCCATAGG + Intronic
1149292176 17:55227931-55227953 CCAGGAGCTGTGGCAGCCATTGG - Intergenic
1151479576 17:74362170-74362192 CCAGGACCACTGGCAGCCATTGG + Intergenic
1152285916 17:79413373-79413395 CCAGAACCTGCTGCATCCAGAGG + Intronic
1152797752 17:82316378-82316400 CGAGCATCTGTGCCATCCTTGGG + Exonic
1152816313 17:82410155-82410177 CCAGCACCTGTGGCAGCTCAGGG - Intronic
1152898786 17:82928382-82928404 CCTGCACCTGAGGCTGCCATTGG + Intronic
1154385437 18:13887979-13888001 CCAACACCTGTGGCCAGCATGGG + Intronic
1155910615 18:31500407-31500429 CTAGCAGATGTGGCATGCATGGG - Intronic
1156405531 18:36779217-36779239 TCAGCACCTGTGGCATTGTTAGG + Intronic
1157422613 18:47559230-47559252 CCAGCACCTGTAGTACCCAAGGG - Intergenic
1157740432 18:50088093-50088115 CCAGCACCTGTGACACACAGCGG + Intronic
1162476893 19:10905643-10905665 CCAGCACCTGTGTCAACCACTGG - Intronic
1164892507 19:31836881-31836903 CCATCATCTCTGCCATCCATAGG + Intergenic
1165112320 19:33509586-33509608 CCAGTCCCTGTGGCAGCCAGGGG + Intronic
1167647129 19:50711884-50711906 CCAGTCCCTGAGGCATCCAAGGG - Intronic
927399897 2:22698660-22698682 CAAGGACCTGTGACACCCATGGG + Intergenic
933099231 2:78230516-78230538 TCAGCACCTGTGGCTTTCAGAGG + Intergenic
937674729 2:124577769-124577791 CCAAACCCTGTGGCATACATGGG + Intronic
939901454 2:147855259-147855281 CCAGAAACTGTGCCATGCATTGG - Intronic
942326545 2:174781285-174781307 CCAGCACCAGCGGTACCCATAGG - Intergenic
945000711 2:205347111-205347133 CCAGCACCTTTGGCAGCAGTGGG - Intronic
1169001968 20:2174414-2174436 CCAGCACCTGTGTCTTTCAGAGG - Intronic
1170712521 20:18805176-18805198 CCAGCATCAGTGGCATCCCTGGG - Intergenic
1171516356 20:25741224-25741246 CCAGCACCTCTGGTATGCCTTGG - Intergenic
1175722901 20:61298078-61298100 TCAGCAACTTTGGCATTCATTGG + Intronic
1178477107 21:32946592-32946614 CCAGCACCTGTGGCTTCCCTTGG - Intergenic
1180195593 21:46191732-46191754 CCACCAACTGTGGCATTCACTGG + Intronic
1180932167 22:19599730-19599752 CCAGCTCCTGAGACAGCCATGGG - Intergenic
1183313149 22:37122439-37122461 CCAGCACCTGTGACAGGCCTGGG - Intergenic
1184270765 22:43381581-43381603 TCAGCACTTGTGGAATGCATGGG + Intergenic
949564843 3:5235119-5235141 CCAGCAGCAATGGCATCCTTAGG - Intergenic
951835811 3:26982450-26982472 CCAGCACCTAGGGCATCATTTGG - Intergenic
952036904 3:29213674-29213696 CCATCACCTTTCACATCCATTGG + Intergenic
952160208 3:30685783-30685805 CCAACACCTGTGGCAGCTGTAGG + Intronic
952923856 3:38307471-38307493 CCAGGCCCTGAGCCATCCATGGG - Intronic
955356911 3:58238733-58238755 CCAGCTCCTGGGGCATACAAAGG - Intronic
958778967 3:98519148-98519170 TGAGAACCAGTGGCATCCATTGG - Intronic
960082112 3:113552818-113552840 CCGGCCCCTTTGACATCCATGGG + Intronic
960988232 3:123294296-123294318 CCAGCAGCCTTTGCATCCATTGG - Intronic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
966653629 3:182328422-182328444 CCAGCACCTGTCTCATGCAAGGG - Intergenic
966967707 3:185011834-185011856 CCAGCATCTGGGTCATTCATAGG - Intronic
967220301 3:187242800-187242822 CCAGCCCCTGGGGCAGCCAGGGG + Intronic
968690171 4:1986236-1986258 CCAGCTCCTGTGGCACCCCGGGG - Intronic
970506530 4:16736006-16736028 CCAGACACTGTGGCATCTATAGG - Intronic
971602806 4:28617100-28617122 CCAGCGCTTTTGGCATTCATTGG - Intergenic
975549710 4:75599833-75599855 CCAGCAACTCTGGCACCCACAGG + Intronic
976823538 4:89234251-89234273 CCTGCAAATGTGGCCTCCATAGG + Intergenic
976912348 4:90323236-90323258 ACAACACCTGTGGCAGCCAAGGG - Intronic
977796329 4:101169463-101169485 CAACCACCTGTGGCAACCCTGGG + Intronic
981784474 4:148462092-148462114 CCATGACTTGTGGCTTCCATAGG + Intergenic
985716727 5:1467174-1467196 CCAGCACCTGTGGCTGCCACTGG + Intronic
989571678 5:42951539-42951561 GCAGCACCTGGGGTTTCCATTGG - Intergenic
992143504 5:73822205-73822227 CCAGCACCTCTGGAATCCACTGG + Intronic
993883959 5:93395190-93395212 CCAGCACCACAGGGATCCATTGG - Intergenic
994239936 5:97407581-97407603 CCGCCACCTGTGGGATCCACTGG + Intergenic
999283319 5:150379280-150379302 CCAGCATCTGTGCCATCTGTGGG + Exonic
999818422 5:155200558-155200580 CCAGCACCACAGGGATCCATTGG + Intergenic
1001244410 5:170095221-170095243 CCAGCCCCTTTGGCATCACTTGG + Intergenic
1001397609 5:171428331-171428353 CCAGCACCTATCCCAGCCATTGG + Intronic
1002085208 5:176770553-176770575 CCAGAAGCTGTGGCATCCATGGG + Intergenic
1002444178 5:179279086-179279108 GCTGCAGCTGTGGCTTCCATGGG - Intronic
1005195452 6:23277947-23277969 CCAGCAGCACTGGCATCAATTGG + Intergenic
1007887454 6:45247079-45247101 TTAGCATCTGTGGGATCCATTGG - Intronic
1015831483 6:137374266-137374288 CCAGACCCTGTAGCATCCAAAGG - Intergenic
1016799256 6:148152433-148152455 ACAGCACCTGTCGCTTCCAAAGG - Intergenic
1017225338 6:152014691-152014713 CCAGGACCTGTGCCATGCAGAGG - Intronic
1017808599 6:157967567-157967589 CCAGCACCTGTCCCACCCAGCGG + Intergenic
1018260277 6:161963362-161963384 CAAGCACCTGTGACATCTCTAGG + Intronic
1020013083 7:4816874-4816896 GCAGCACCTCTGGCACCCGTGGG + Intronic
1022586457 7:31618018-31618040 CCAGTAGTTGTGGCATCCATGGG + Intronic
1023338320 7:39193108-39193130 CCAGCAGCATTGGCATCCCTTGG - Intronic
1030179791 7:106694121-106694143 CCATCACCTGGGACATCCTTAGG - Intergenic
1031228530 7:119074265-119074287 CCAGCAGCTTTGGCATCACTTGG - Intergenic
1031857804 7:126943053-126943075 CCAGCAGCTTTGGCATCACTTGG - Intronic
1032411552 7:131697122-131697144 CCATCAGCTGTGGCATCACTTGG - Intergenic
1032490180 7:132318501-132318523 CCTGCAGCTGAGGCATCCCTTGG - Intronic
1034413596 7:150953846-150953868 CCAGCACCTCTGGAATTCATGGG - Intronic
1034457130 7:151176670-151176692 CCAGCACCTGTGGGAGGCAGAGG + Exonic
1034997119 7:155584570-155584592 CCAGCACCTCCAGCCTCCATCGG + Intergenic
1037931181 8:22881187-22881209 CCAGAAACTGGGGCATCCCTGGG - Intronic
1040466914 8:47703937-47703959 GCAGCACCTATGGCATCCTTAGG - Intronic
1040518813 8:48157641-48157663 CCAGGACCTGAGGCCTTCATGGG + Intergenic
1042264178 8:66891845-66891867 CCAGCACCTGTGCCAGCCCCTGG - Intronic
1042668974 8:71239730-71239752 CAAGCACCTGTGAGATCCTTTGG + Intronic
1051364716 9:16313342-16313364 CCAGCCCCTGATGGATCCATGGG - Intergenic
1052240177 9:26262066-26262088 TCAGCTCCTGTGGCGTCCTTTGG + Intergenic
1055144261 9:72913770-72913792 CCAGCAGTTGTGGCATCACTTGG + Intronic
1059634821 9:116160282-116160304 TCAGGACCTGTGGCACCCAGGGG - Intronic
1059839077 9:118191910-118191932 CCAGCAGCTGTGGTAGACATGGG + Intergenic
1061092414 9:128434086-128434108 CAACCACCTGTGGCATACAATGG - Exonic
1061559993 9:131395688-131395710 CCAGCACCTGTGGCATCCATGGG - Intronic
1061608197 9:131727544-131727566 CCTGGACCTGTGGCATCTTTGGG - Intronic
1061796912 9:133090974-133090996 CCAGCACCCTTGGCATCCTCTGG - Intergenic
1062005365 9:134236076-134236098 CCAGGAGCTGTGGCATCCCCAGG + Intergenic
1187021215 X:15384272-15384294 CTAGAACCTGCGGCATACATTGG - Exonic
1187376292 X:18758073-18758095 CCAGCACAAGTGGCATGCAGAGG - Intronic
1187701647 X:21969174-21969196 CCAACCCCTGTGGCATTAATTGG + Intronic
1193871295 X:86802186-86802208 CCAGCAACTTTAGCATCAATTGG + Intronic
1196764273 X:119228763-119228785 CCAGAAGCTTTGGCATCCACTGG - Intergenic
1198347458 X:135772616-135772638 TCAGCAACTGTGACATCCCTCGG + Intergenic
1198349363 X:135789877-135789899 TCAGCAACTGTGACATCCCTCGG + Intergenic
1198351268 X:135807150-135807172 TCAGCAACTGTGACATCCCTCGG + Intergenic
1198353176 X:135824416-135824438 TCAGCAACTGTGACATCCCTCGG + Intergenic
1198355084 X:135841670-135841692 TCAGCAACTGTGACATCCCTCGG + Intergenic
1198356994 X:135858953-135858975 TCAGCAACTGTGACATCCCTCGG + Intergenic
1198358908 X:135876232-135876254 TCAGCAACTGTGACATCCCTCGG + Intergenic