ID: 1061560022

View in Genome Browser
Species Human (GRCh38)
Location 9:131395851-131395873
Sequence GCAGTTGGTCAGTTTAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061560019_1061560022 -10 Left 1061560019 9:131395838-131395860 CCCGGAGTGTGTGGCAGTTGGTC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1061560022 9:131395851-131395873 GCAGTTGGTCAGTTTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061560022 Original CRISPR GCAGTTGGTCAGTTTAAGGC AGG Intronic
No off target data available for this crispr