ID: 1061560124 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:131396605-131396627 |
| Sequence | AAGACCGGGCGCGGTAGCTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1061560124_1061560129 | 20 | Left | 1061560124 | 9:131396605-131396627 | CCTGAGCTACCGCGCCCGGTCTT | No data | ||
| Right | 1061560129 | 9:131396648-131396670 | TTTCCTCTTCTCTTGGTTGATGG | No data | ||||
| 1061560124_1061560128 | 13 | Left | 1061560124 | 9:131396605-131396627 | CCTGAGCTACCGCGCCCGGTCTT | No data | ||
| Right | 1061560128 | 9:131396641-131396663 | CTTATTTTTTCCTCTTCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1061560124 | Original CRISPR | AAGACCGGGCGCGGTAGCTC AGG (reversed) | Intronic | ||