ID: 1061560125

View in Genome Browser
Species Human (GRCh38)
Location 9:131396614-131396636
Sequence AAGAGAAAGAAGACCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061560125_1061560128 4 Left 1061560125 9:131396614-131396636 CCGCGCCCGGTCTTCTTTCTCTT No data
Right 1061560128 9:131396641-131396663 CTTATTTTTTCCTCTTCTCTTGG No data
1061560125_1061560129 11 Left 1061560125 9:131396614-131396636 CCGCGCCCGGTCTTCTTTCTCTT No data
Right 1061560129 9:131396648-131396670 TTTCCTCTTCTCTTGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061560125 Original CRISPR AAGAGAAAGAAGACCGGGCG CGG (reversed) Intronic