ID: 1061560126

View in Genome Browser
Species Human (GRCh38)
Location 9:131396619-131396641
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061560126_1061560129 6 Left 1061560126 9:131396619-131396641 CCCGGTCTTCTTTCTCTTAATGC No data
Right 1061560129 9:131396648-131396670 TTTCCTCTTCTCTTGGTTGATGG No data
1061560126_1061560128 -1 Left 1061560126 9:131396619-131396641 CCCGGTCTTCTTTCTCTTAATGC No data
Right 1061560128 9:131396641-131396663 CTTATTTTTTCCTCTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061560126 Original CRISPR GCATTAAGAGAAAGAAGACC GGG (reversed) Intronic