ID: 1061560129

View in Genome Browser
Species Human (GRCh38)
Location 9:131396648-131396670
Sequence TTTCCTCTTCTCTTGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061560126_1061560129 6 Left 1061560126 9:131396619-131396641 CCCGGTCTTCTTTCTCTTAATGC No data
Right 1061560129 9:131396648-131396670 TTTCCTCTTCTCTTGGTTGATGG No data
1061560127_1061560129 5 Left 1061560127 9:131396620-131396642 CCGGTCTTCTTTCTCTTAATGCT No data
Right 1061560129 9:131396648-131396670 TTTCCTCTTCTCTTGGTTGATGG No data
1061560124_1061560129 20 Left 1061560124 9:131396605-131396627 CCTGAGCTACCGCGCCCGGTCTT No data
Right 1061560129 9:131396648-131396670 TTTCCTCTTCTCTTGGTTGATGG No data
1061560125_1061560129 11 Left 1061560125 9:131396614-131396636 CCGCGCCCGGTCTTCTTTCTCTT No data
Right 1061560129 9:131396648-131396670 TTTCCTCTTCTCTTGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061560129 Original CRISPR TTTCCTCTTCTCTTGGTTGA TGG Intronic