ID: 1061566424

View in Genome Browser
Species Human (GRCh38)
Location 9:131443831-131443853
Sequence GCCTCCTATAAAATCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061566424_1061566425 -8 Left 1061566424 9:131443831-131443853 CCTGGGCTGATTTTATAGGAGGC 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1061566425 9:131443846-131443868 TAGGAGGCTGTGCTTGTCTGTGG No data
1061566424_1061566426 -1 Left 1061566424 9:131443831-131443853 CCTGGGCTGATTTTATAGGAGGC 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1061566426 9:131443853-131443875 CTGTGCTTGTCTGTGGCCCCAGG No data
1061566424_1061566430 24 Left 1061566424 9:131443831-131443853 CCTGGGCTGATTTTATAGGAGGC 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1061566430 9:131443878-131443900 GTCAGTAGAACCTTCCCTGCTGG No data
1061566424_1061566431 25 Left 1061566424 9:131443831-131443853 CCTGGGCTGATTTTATAGGAGGC 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1061566431 9:131443879-131443901 TCAGTAGAACCTTCCCTGCTGGG No data
1061566424_1061566433 30 Left 1061566424 9:131443831-131443853 CCTGGGCTGATTTTATAGGAGGC 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1061566433 9:131443884-131443906 AGAACCTTCCCTGCTGGGGCAGG No data
1061566424_1061566432 26 Left 1061566424 9:131443831-131443853 CCTGGGCTGATTTTATAGGAGGC 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1061566432 9:131443880-131443902 CAGTAGAACCTTCCCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061566424 Original CRISPR GCCTCCTATAAAATCAGCCC AGG (reversed) Intronic
900864570 1:5258985-5259007 GCCTCCTGTCAAATCAGCAGCGG + Intergenic
904573807 1:31488781-31488803 GGCTCCTTTAAAATAAGCCTGGG - Intergenic
904938682 1:34149806-34149828 CCCTCCTTTACAATTAGCCCTGG - Intronic
907788264 1:57635416-57635438 GCCTCCTATCAGATCAGCTATGG + Intronic
908010810 1:59775733-59775755 GGCTCCTGTAAAAGCAGCCTTGG - Intergenic
908417199 1:63924768-63924790 GCCTCCTACAAAATGCTCCCAGG - Intronic
909617880 1:77632931-77632953 TTCTCCTATAAAATCAGACAAGG - Exonic
914319873 1:146548822-146548844 GCCTCCTGTCAGATCAGCCGCGG + Intergenic
916989344 1:170225681-170225703 GATTTCTATAAAATCAGCTCTGG - Intergenic
918645839 1:186903564-186903586 GCCTCCTGTAAGATCAGCGGTGG + Intronic
919515863 1:198521962-198521984 GCCTCCTGTCAAATCAGCAGCGG + Intergenic
920973167 1:210759966-210759988 GCCTCCTATCAGATCAGCAGTGG + Intronic
921557546 1:216616651-216616673 GCGGCCTATAAAATCAGCAAAGG - Intronic
921988143 1:221334836-221334858 GCCTCCTGTCAGATCAGCCACGG - Intergenic
922176431 1:223201500-223201522 GCCTCCTCCCAAAGCAGCCCTGG + Intergenic
922418607 1:225444179-225444201 GGGTTCTATAAAGTCAGCCCTGG - Intergenic
923491187 1:234485563-234485585 GCCTCCTATCAAATCAGCAGCGG + Intergenic
1064881998 10:20065784-20065806 GCCTCCTGTCAGATCAGCACTGG - Intronic
1065715370 10:28561760-28561782 GCCTCCTGTCAGATCAGCCACGG + Intronic
1070590687 10:77798634-77798656 GCCTCCCAGAAACACAGCCCCGG - Intronic
1072075105 10:91963257-91963279 GCCTTTTAAAAAATCAGCCAAGG - Intronic
1072125529 10:92442218-92442240 GCCTCCTATAAATTTAACCCAGG + Intergenic
1073179033 10:101573012-101573034 GCATCCTTGAAAAGCAGCCCTGG - Intronic
1075977929 10:126712933-126712955 GCCTCCTGTCAAATCAGCAGTGG + Intergenic
1076333184 10:129686665-129686687 TCCTCATTTAAAAACAGCCCTGG - Intronic
1077085785 11:749756-749778 TCGTCCTGTAAAATCACCCCTGG - Intronic
1078668087 11:13342317-13342339 GGCTCCTCTGAAAGCAGCCCAGG - Intronic
1079883108 11:25951389-25951411 GCCTCCTGTCAGATCAGCCATGG + Intergenic
1082957461 11:58885613-58885635 TCACCCTATAAAAGCAGCCCTGG - Intronic
1084956866 11:72696264-72696286 GCCTCCTGTCAGATCAGCCGCGG - Intronic
1085382727 11:76134962-76134984 GCCTCCCATCAGATCAGCCATGG + Intronic
1085498367 11:76993832-76993854 GCCTCTTATCAAATCAGCAGTGG - Intronic
1086359648 11:86044739-86044761 GCCTCCTATCAGATCAGCAGGGG + Intronic
1087177877 11:95111648-95111670 GCCTCCTATGAGATCAGCTGTGG - Intronic
1087656482 11:100929269-100929291 GCCTCCTATCAGATCAGTGCTGG - Intronic
1088317280 11:108520139-108520161 GCCTCCAGTCAGATCAGCCCTGG + Intronic
1091437646 12:485221-485243 GCCTCCTCTCACATCAGGCCAGG - Intronic
1091574478 12:1720617-1720639 GCCTCCTGTAAAATCAGCGGTGG - Intronic
1093430639 12:19081278-19081300 GCATCCTATAAAATAAACTCAGG - Intergenic
1093879219 12:24384285-24384307 GCCTCCTATCAGAGCAGCCATGG - Intergenic
1097824617 12:64162316-64162338 GCCTCCTGTCAGATCAGCCAAGG + Intergenic
1100795006 12:98172655-98172677 GCCTTCAATAAAATCAACCCTGG - Intergenic
1102540444 12:113615200-113615222 GACTCATAGAAAATCAGGCCTGG + Intergenic
1104044439 12:125151860-125151882 GCCTCCTGTCAGATCAGCCGTGG + Intergenic
1105632868 13:22188495-22188517 CTCTCCTATAAAATCAGCCTGGG + Intergenic
1107515767 13:41127378-41127400 GCCTCCTATTAGATCAGCAGTGG - Intergenic
1110316559 13:74115048-74115070 GCCTTCCATGAAACCAGCCCTGG + Intronic
1110552456 13:76824754-76824776 GCCTCCTGTCAGATCTGCCCTGG - Intergenic
1112931073 13:104738886-104738908 GCCTCCTATCAGATCAGCACCGG - Intergenic
1114333324 14:21660252-21660274 GCCTCCTGTCAGATCAGCCTTGG - Intergenic
1118075235 14:62290944-62290966 GCCTCATATAAATTAAGCCTTGG + Intergenic
1120192860 14:81454930-81454952 GCCTCCCTTTTAATCAGCCCTGG + Intergenic
1120618762 14:86737398-86737420 GCCTCCTGTCAGATCAGCCGTGG + Intergenic
1121177827 14:91904459-91904481 GGCTGCTTTCAAATCAGCCCTGG - Intronic
1125284047 15:38073124-38073146 GCCTGCTGAAAAAGCAGCCCGGG - Intergenic
1125835564 15:42747609-42747631 GCCTCCTATCAGATCAGCAGTGG - Intronic
1128905815 15:71466726-71466748 GCCTCCTAGAAAGACAGCCCTGG - Intronic
1129639130 15:77355836-77355858 CCCTCCCAGAATATCAGCCCTGG + Intronic
1130781047 15:87041719-87041741 GCCTCCTGTCAAATCAGCCAGGG + Intergenic
1131631931 15:94186720-94186742 GCCTCCTATCAGATCAGCGGTGG - Intergenic
1140013653 16:71161255-71161277 GCCTCCTGTCAGATCAGCCGCGG - Intronic
1141281429 16:82632990-82633012 GCCTCCTGTCAGATCAGCCGTGG - Intronic
1141376862 16:83539325-83539347 GCCTCCTGTCAGATCAGCCATGG - Intronic
1142617569 17:1145408-1145430 GCCTTAAATCAAATCAGCCCAGG - Intronic
1144424608 17:15130149-15130171 GCCTGGTGTTAAATCAGCCCAGG - Intergenic
1147950463 17:44104848-44104870 GCCTCCTATGTCCTCAGCCCGGG - Intronic
1148709080 17:49663187-49663209 GCCTCCTGTGAGATCAGCCATGG + Intronic
1151275372 17:73030136-73030158 GCCTCCTGTCAGATCAGCCGTGG - Intronic
1151387569 17:73764507-73764529 GCCTCCTATAACATCACCATGGG - Intergenic
1153309623 18:3665513-3665535 GCCACATATAAAATAAGCTCAGG + Intronic
1155123073 18:22842494-22842516 GCCTCTCCTACAATCAGCCCTGG - Intronic
1155394160 18:25368556-25368578 GCCTCCTGTCAAATCAGCAGCGG - Intergenic
1157715592 18:49884578-49884600 GCCTCCTGTCAAATCAGCAGTGG - Intronic
1158443474 18:57498593-57498615 GTCTCCTAAAAATTCAGCCAGGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161851592 19:6740353-6740375 GTCGCCTATAACCTCAGCCCTGG + Intronic
1162037441 19:7949324-7949346 GCCTCCTGTAAGATCAGCAGCGG - Intergenic
1164052539 19:21595503-21595525 ACCTCCTAAAAAAAGAGCCCAGG - Intergenic
1164793994 19:31011705-31011727 GCCTCCTATCACATCAGCTGCGG + Intergenic
1164945112 19:32286879-32286901 GCCTCCTGTCAAATCAGCAGTGG - Intergenic
1165124536 19:33584290-33584312 GCCTCCTGTCAAATCAGCGGTGG - Intergenic
1165507860 19:36245754-36245776 CCCTCCAAGAAAAGCAGCCCGGG - Intronic
925439480 2:3872054-3872076 GCCTCCTGTCAGATCGGCCCAGG - Intergenic
932310153 2:70733270-70733292 GCCTCCTTAAAAAGCAGCCGAGG - Intronic
932855285 2:75227395-75227417 GCATCCCATAAAGTCTGCCCAGG - Intergenic
934660680 2:96142148-96142170 GCCTCCTATCAGATCAGCGGTGG - Intergenic
938863161 2:135391266-135391288 GAGTCATATAAAATCAGCACTGG - Intronic
939152808 2:138493414-138493436 GCCTACCATGAAATCAGCCCTGG - Intergenic
940375119 2:152948988-152949010 GCCTCCTGTCAAATCAGCAGTGG - Intergenic
940955446 2:159721881-159721903 CACACCTACAAAATCAGCCCTGG + Intronic
941064296 2:160883688-160883710 GCTTCTTATAAAATCAGCTTAGG + Intergenic
941066233 2:160906062-160906084 GCCTCCCATAAAAGCAGGCAAGG + Intergenic
941398708 2:165003916-165003938 GCCTCCCATCAGATCAGCCTTGG + Intergenic
946995032 2:225381783-225381805 GCCTCCTGTCAAATCAGCAGTGG - Intergenic
947561719 2:231159950-231159972 GCCTCCTGTCAAATCAGCTGTGG - Intronic
947653601 2:231808016-231808038 GCCTCCTTCACAATCATCCCTGG - Exonic
948025235 2:234771247-234771269 CCCTCTTAGAACATCAGCCCCGG - Intergenic
948108782 2:235437487-235437509 GCCTCCTATCAGATCAGCGGGGG - Intergenic
1169550353 20:6695829-6695851 GCCTCCTGTCAGATCAGCCAGGG - Intergenic
1172007058 20:31824768-31824790 GCCTCCTCTGAACCCAGCCCAGG - Intronic
1172826470 20:37791682-37791704 GCCTCCTATAAGGTCAGCAGTGG + Intronic
1174533198 20:51230920-51230942 GTCTCCTATGAAATCAGCCTGGG + Intergenic
1175497837 20:59426975-59426997 ACCTCTTATAAAGTCAGCCAGGG + Intergenic
1175504697 20:59473304-59473326 GCCTCCTATTAGATCAGCAGTGG - Intergenic
1176980241 21:15373552-15373574 GCCTACTATAAAGTTAGCACTGG - Intergenic
1177166222 21:17607890-17607912 GACTCCTATAAAACATGCCCTGG - Intronic
1178705509 21:34869594-34869616 GCCACGTATAAACTCAGCACTGG - Intronic
1183376376 22:37467774-37467796 GCATCCCATAAACCCAGCCCTGG + Intergenic
1183503755 22:38196955-38196977 GCCTCCTGTAGGATCAGCACTGG - Intronic
1185125533 22:49008772-49008794 GCCTCCTATCAGATCAGCCGTGG - Intergenic
949434435 3:4013213-4013235 GCCTCCTGTCAGATCAGCCATGG - Intronic
949956482 3:9273203-9273225 ACCTCCTATCAGATCAGCCATGG - Intronic
958500686 3:94904465-94904487 GATTCCAATAAAACCAGCCCAGG - Intergenic
960163151 3:114372414-114372436 TCCTCTTATAAAATCCTCCCAGG - Intronic
960443158 3:117714406-117714428 ACCTCCTCTAAGATCAGCCATGG + Intergenic
964551890 3:157893994-157894016 CCCTACTATTAATTCAGCCCTGG + Intergenic
964732823 3:159885469-159885491 GCTTCCAAAAACATCAGCCCTGG + Intronic
965724915 3:171704987-171705009 GCCTCCTGTCAGATCAGCCGTGG - Intronic
971388475 4:26162914-26162936 GCCTTCTGTAACATAAGCCCTGG - Intergenic
973272107 4:48271775-48271797 GCCTCCTGTCAGATCAGCCTTGG - Intergenic
973586475 4:52397341-52397363 ACCTCCTATCAGATCAGCCAAGG + Intergenic
974974658 4:68875188-68875210 TCCTCCCAGAAAATGAGCCCTGG + Intergenic
977708773 4:100100499-100100521 TCCACCTATAAATACAGCCCTGG - Intergenic
981497900 4:145414033-145414055 GCTTGCTATAAAGACAGCCCTGG - Intergenic
982073100 4:151713019-151713041 GCCTCCTGTCAGATCAGCCATGG + Intronic
984642187 4:182179221-182179243 GCCTGCTCTAAAAGCACCCCAGG + Intronic
986007888 5:3683460-3683482 GGTTCTAATAAAATCAGCCCTGG - Intergenic
987091701 5:14513426-14513448 GCCTCCTGTCAGATCAGCCTGGG - Intronic
989472511 5:41836719-41836741 GCCTCCTGTTAGATCAGCCCTGG - Intronic
989734160 5:44682961-44682983 GCTTCCAATAAAATCAGAACTGG + Intergenic
990255561 5:53965072-53965094 GCCTCCTTTAACTTCTGCCCAGG + Intronic
990442580 5:55861384-55861406 GCCTCCTGTCAAATCAGCAGCGG + Intronic
991160444 5:63492841-63492863 GCCTCCTATCAGATCAGCAGTGG + Intergenic
992518382 5:77521310-77521332 GCCTCCTGTCAGATCAGCCTCGG - Intronic
992744308 5:79804214-79804236 TCCTGCTCTAAAAACAGCCCAGG - Intergenic
994269095 5:97755255-97755277 CACTCCTCTAAAATCAGCCCTGG - Intergenic
994790527 5:104221020-104221042 GCCTCCCCTACAATCATCCCTGG + Intergenic
995637325 5:114208565-114208587 GCTTCGTATAAAAGCATCCCAGG - Intergenic
996551620 5:124736370-124736392 GCCATCCATAAAATCAGCCAAGG + Intronic
997498959 5:134356262-134356284 GCCTCCTATCAGATCAGCAGAGG - Intronic
998096161 5:139396575-139396597 CCTTCCTATATAAACAGCCCTGG - Intronic
998622824 5:143813013-143813035 ACCTCCTATAACGTCAACCCAGG - Intronic
1004244211 6:13956841-13956863 GCTTCCTTTCATATCAGCCCAGG - Intronic
1004311929 6:14553662-14553684 GCCTCCTATCACATCAGCAGCGG - Intergenic
1004875202 6:19944441-19944463 ACCTCCTATCAGATCAGCCTTGG - Intergenic
1005387962 6:25304572-25304594 GCCTCCTGTCAGATCAGCCAAGG - Intronic
1012979846 6:105817949-105817971 GCCTCCTATCAGATCAGCAGCGG + Intergenic
1013191032 6:107804301-107804323 GTCTGCTACAAAATAAGCCCTGG + Intronic
1015001274 6:128219465-128219487 GCCTCCTATCAGATCAGCTGTGG - Intronic
1015854694 6:137611061-137611083 GCCTCCTATAAACACAACCCTGG + Intergenic
1016702288 6:147067388-147067410 GCCTCCTATCAGATCAGCTGCGG - Intergenic
1017157685 6:151337099-151337121 GCCTCCTCTAAAATCAGGTTGGG + Intronic
1018396500 6:163381893-163381915 GCCTCATATAAAATATGCACAGG - Intergenic
1019657069 7:2201507-2201529 GCCTCCTCTAAAATAAATCCTGG + Intronic
1020699239 7:11457679-11457701 GCCTTCCACAAAATCACCCCAGG + Intronic
1021176151 7:17451774-17451796 GAGCCCTATAAAATTAGCCCAGG - Intergenic
1022357650 7:29630940-29630962 GCCAGCTGTAAAATCAGCCAGGG + Intergenic
1022579379 7:31533993-31534015 GCCTCCTGTCAGATCAGCCATGG + Intronic
1024204871 7:47149414-47149436 GCCTCCTGTCAGATCAGCACCGG + Intergenic
1024237662 7:47410107-47410129 GCCTCCTAGGAAACAAGCCCAGG + Intronic
1025120047 7:56294118-56294140 GGATGCTATAAAAACAGCCCTGG - Intergenic
1030291882 7:107880886-107880908 GCCTCCTGTCACATCAGCCAAGG - Intergenic
1030937519 7:115603669-115603691 GCCTCCTGTCAAATCAGCGAGGG + Intergenic
1030992422 7:116316382-116316404 GCCACTGATAAAATCAGCTCAGG - Intronic
1031221836 7:118976456-118976478 GCCTCCTATCAGATCAGCAGGGG - Intergenic
1032385411 7:131519384-131519406 TCCTCCTTTAAGACCAGCCCAGG + Intronic
1032632926 7:133673086-133673108 AGCTCCTCTAAAATAAGCCCTGG - Intronic
1038894525 8:31767201-31767223 GCTCTCTATAAAATCAGCCAAGG - Intronic
1042068738 8:64907102-64907124 GCCTCCTATCAGATCAGCGGTGG - Intergenic
1043308823 8:78832486-78832508 GCCTCCTGTCAGATCAGCCGAGG - Intergenic
1044713280 8:95077116-95077138 GCCTTCGAAAAAATCAACCCTGG + Intronic
1044848596 8:96406198-96406220 GCCTCCTGTCAGATCAGCGCTGG - Intergenic
1050299262 9:4240336-4240358 GCCTCCTGTCAGATCAGCACTGG - Intronic
1052202403 9:25798979-25799001 GCCTCCTATCAGATCAGCGGTGG + Intergenic
1055045368 9:71918623-71918645 GCCTCCTGTCAGATCAGCTCTGG + Intronic
1058068103 9:100571937-100571959 GCCTCCTGTCAGATCAGCACTGG - Intronic
1061566424 9:131443831-131443853 GCCTCCTATAAAATCAGCCCAGG - Intronic
1186647727 X:11524983-11525005 GCCTCCCATCAAATCAGCAGCGG - Intronic
1188292835 X:28410155-28410177 GCCTCCTGTCAGATCAGCCATGG + Intergenic
1188333780 X:28902810-28902832 GCCTCCTATCAGATCAGCAGTGG + Intronic
1189429432 X:40933900-40933922 GCCTCCTAAATACTCAGCCAAGG + Intergenic
1189675777 X:43459080-43459102 GCTGACTATAAAGTCAGCCCAGG + Intergenic
1190125812 X:47704482-47704504 GCTGACTATAAAGTCAGCCCAGG - Intergenic
1197982153 X:132228362-132228384 GCCTCCTATCAGATCAGCAGCGG + Intergenic
1198142027 X:133813927-133813949 GCATCATATAAAAGCAACCCCGG + Intronic
1198144818 X:133844517-133844539 GGCCCCTATACAAACAGCCCTGG - Intronic