ID: 1061569802

View in Genome Browser
Species Human (GRCh38)
Location 9:131470207-131470229
Sequence GACCTACGGTGTTACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061569802_1061569809 8 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569809 9:131470238-131470260 CCTCGTAGGATTTAGGCGTCGGG No data
1061569802_1061569810 11 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569810 9:131470241-131470263 CGTAGGATTTAGGCGTCGGGTGG No data
1061569802_1061569812 21 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569812 9:131470251-131470273 AGGCGTCGGGTGGAGAGCGGTGG No data
1061569802_1061569806 1 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569806 9:131470231-131470253 CGAGTAGCCTCGTAGGATTTAGG No data
1061569802_1061569811 18 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569811 9:131470248-131470270 TTTAGGCGTCGGGTGGAGAGCGG No data
1061569802_1061569805 -6 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569805 9:131470224-131470246 TAGGTCACGAGTAGCCTCGTAGG No data
1061569802_1061569807 7 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569807 9:131470237-131470259 GCCTCGTAGGATTTAGGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061569802 Original CRISPR GACCTACGGTGTTACAGTGA GGG (reversed) Intronic
907564679 1:55423862-55423884 GACCTACTGTGTGCCAGTGTGGG + Intergenic
909047635 1:70729175-70729197 GGCCTGGGGTATTACAGTGAGGG - Intergenic
909161486 1:72156651-72156673 GAACTACAGTGTTTCTGTGATGG + Intronic
917020533 1:170581638-170581660 GAGCTACTGTGTTAAAATGATGG - Intergenic
922005090 1:221522195-221522217 GACCCACGGAGATGCAGTGAAGG - Intergenic
1063000727 10:1918752-1918774 GCCCTATGGTGTTTCAGTGCAGG - Intergenic
1081854058 11:46292992-46293014 GACCAATGGTGTGACAATGAAGG - Intronic
1089598184 11:119595752-119595774 GACCTACCTTGTTAGATTGAAGG - Intergenic
1101490436 12:105204886-105204908 GACCTCCAGTGTTACATTGACGG - Intronic
1109131940 13:58597937-58597959 GAACTACTGGGTTAGAGTGATGG - Intergenic
1110453712 13:75666492-75666514 GACCTATGGTGGTGTAGTGAGGG + Intronic
1114152509 14:20060143-20060165 GATCTACGGTGCTACTGTGATGG + Exonic
1115114221 14:29860245-29860267 GACCCACTGTGTTGCAGCGAAGG + Intronic
1118711157 14:68520711-68520733 GACCTACTGTGTGCCAGTTAGGG + Intronic
1134252371 16:12583357-12583379 GACCCACTGTGTCTCAGTGATGG + Intergenic
1135499927 16:22986598-22986620 GAATTACTGTGTCACAGTGATGG - Intergenic
1160628764 18:80231006-80231028 GACCTAAAGAGCTACAGTGATGG + Intronic
932286860 2:70541856-70541878 GACCTAGGGTGTTATAATTAGGG - Intronic
938093519 2:128447901-128447923 GACCCACTGCGTTACAGTGGGGG + Intergenic
938093559 2:128448013-128448035 GACCCACAGCGTTACAGTGGGGG + Intergenic
938093588 2:128448087-128448109 GACCCACAGCGTTACAGTGGGGG + Intergenic
939110913 2:138005967-138005989 GACATACGGTGTTAAAGTATGGG - Intronic
945054599 2:205857479-205857501 GACCAAGGGTGTTACAATGGTGG - Intergenic
945833774 2:214814265-214814287 GGACTACAGTGTTACAGTGGGGG - Intergenic
946026048 2:216672621-216672643 GGGCTACGGTGTGACAGTGGCGG + Exonic
947205903 2:227660998-227661020 GACCTACAGTCATACAGGGAAGG + Intergenic
1176047015 20:63097881-63097903 AACCTGCCGTGGTACAGTGAGGG - Intergenic
1177408729 21:20702438-20702460 GACCTGCGGTGTGTCCGTGAGGG - Intergenic
1181537948 22:23556383-23556405 GACCCTCAGTGTGACAGTGAAGG - Intergenic
949188261 3:1219647-1219669 GATCTAAGGTGTTAAAGTCAGGG + Intronic
956643852 3:71437571-71437593 GACCTGGGGTGTTCCTGTGATGG - Intronic
960369450 3:116815863-116815885 GACCTTGGGTGTTATAGTCAGGG - Intronic
967566360 3:190978456-190978478 TACCTACTGTGATACTGTGAAGG - Intergenic
969322738 4:6422846-6422868 GTCCTACTGTGTTACTGTTATGG - Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
985066647 4:186128503-186128525 GAGCTAAGGTGTTCCAGGGAAGG - Intronic
997858269 5:137392505-137392527 GATCTCTGGAGTTACAGTGAAGG + Intronic
1008331628 6:50252536-50252558 GACTGATGGTGTTCCAGTGACGG + Intergenic
1010514254 6:76753724-76753746 GACCTACCCTGGGACAGTGAGGG + Intergenic
1019843048 7:3468568-3468590 GACCTACGGTGTTTGACTGTAGG + Intronic
1022490947 7:30817182-30817204 GACCTTTGGTGTTACAGACAAGG - Intronic
1023250795 7:38258836-38258858 GACCTGCGTTGTTGCAGTGATGG + Intergenic
1031325084 7:120385815-120385837 GAGCTACAGTTGTACAGTGAAGG - Intronic
1043197560 8:77316916-77316938 GTCCAACGGTGTTTCAGTCAAGG + Intergenic
1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG + Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1196837860 X:119829840-119829862 GACAAACCATGTTACAGTGAGGG - Intergenic
1199708194 X:150449368-150449390 CACATACGCTGTTACACTGAGGG - Intronic
1200716819 Y:6556360-6556382 GAGCTACAGTGGTACAGTGCTGG + Intergenic