ID: 1061569806

View in Genome Browser
Species Human (GRCh38)
Location 9:131470231-131470253
Sequence CGAGTAGCCTCGTAGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061569803_1061569806 0 Left 1061569803 9:131470208-131470230 CCTCACTGTAACACCGTAGGTCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1061569806 9:131470231-131470253 CGAGTAGCCTCGTAGGATTTAGG No data
1061569800_1061569806 5 Left 1061569800 9:131470203-131470225 CCAACCCTCACTGTAACACCGTA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1061569806 9:131470231-131470253 CGAGTAGCCTCGTAGGATTTAGG No data
1061569802_1061569806 1 Left 1061569802 9:131470207-131470229 CCCTCACTGTAACACCGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1061569806 9:131470231-131470253 CGAGTAGCCTCGTAGGATTTAGG No data
1061569799_1061569806 6 Left 1061569799 9:131470202-131470224 CCCAACCCTCACTGTAACACCGT 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1061569806 9:131470231-131470253 CGAGTAGCCTCGTAGGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061569806 Original CRISPR CGAGTAGCCTCGTAGGATTT AGG Intronic
No off target data available for this crispr