ID: 1061569995

View in Genome Browser
Species Human (GRCh38)
Location 9:131471587-131471609
Sequence CTAGTCAGTTTTGGTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061569992_1061569995 8 Left 1061569992 9:131471556-131471578 CCAGATAGTAAGTCTTTTAGGCC 0: 1
1: 0
2: 45
3: 423
4: 1228
Right 1061569995 9:131471587-131471609 CTAGTCAGTTTTGGTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061569995 Original CRISPR CTAGTCAGTTTTGGTGTTGT AGG Intronic
No off target data available for this crispr