ID: 1061570320

View in Genome Browser
Species Human (GRCh38)
Location 9:131474061-131474083
Sequence CTGGGGCTATGGGGGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 474}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061570320_1061570337 29 Left 1061570320 9:131474061-131474083 CCCTGCCACCCCCATAGCCCCAG 0: 1
1: 0
2: 5
3: 68
4: 474
Right 1061570337 9:131474113-131474135 GCTCTTGCTCTTTGACCCGGAGG No data
1061570320_1061570331 -3 Left 1061570320 9:131474061-131474083 CCCTGCCACCCCCATAGCCCCAG 0: 1
1: 0
2: 5
3: 68
4: 474
Right 1061570331 9:131474081-131474103 CAGACTCTTCACGGCCTCCCAGG No data
1061570320_1061570336 26 Left 1061570320 9:131474061-131474083 CCCTGCCACCCCCATAGCCCCAG 0: 1
1: 0
2: 5
3: 68
4: 474
Right 1061570336 9:131474110-131474132 CTTGCTCTTGCTCTTTGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061570320 Original CRISPR CTGGGGCTATGGGGGTGGCA GGG (reversed) Intronic
900185875 1:1333011-1333033 CTGAAGCTGTGGGTGTGGCAGGG + Exonic
900384703 1:2405014-2405036 CTGGGGGTATGGGGGCTGCCAGG - Exonic
900561992 1:3311817-3311839 CTGGGTCTATCTGGGAGGCAGGG - Intronic
900705231 1:4076306-4076328 CTGGGACTGTGGGGATGGGAGGG + Intergenic
900737784 1:4310035-4310057 CTGGGGCTCAGGGTGAGGCATGG + Intergenic
900976255 1:6018432-6018454 GTGGGGCTCTGGGGGTGATAAGG + Intronic
901022371 1:6261693-6261715 CTGAGCCTGTGGGGGTGGCGGGG - Intergenic
901055265 1:6446288-6446310 CTGGGGCTGTGGGGGTGGGGGGG - Intronic
901061688 1:6474664-6474686 CTGGGGCTGTGGGTGGGGCGGGG - Intronic
901871752 1:12142545-12142567 CTGGGGCTAGGAGGGCAGCAGGG + Exonic
901878697 1:12181507-12181529 CGGGGGATTTGGGGGTGTCATGG - Intronic
902479105 1:16702325-16702347 CTGGGGCTGTGGGGGTGGGGGGG + Intergenic
902503721 1:16926411-16926433 ATGGGGACAAGGGGGTGGCAGGG - Intronic
902640374 1:17762880-17762902 CTGCGTCCATGGGGGTGGTAGGG + Intronic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903508376 1:23854398-23854420 CTGGGGCTATCGTCGTGACATGG - Exonic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904265697 1:29317513-29317535 CTGAGGTTATGTGGGTGGCAAGG + Intronic
904272229 1:29357555-29357577 CTGGGGCTAGGGGGGACACAGGG - Intergenic
904283524 1:29438155-29438177 CTGGGGCAATGGGGGTGATTAGG - Intergenic
904391769 1:30190715-30190737 CTGGGGCTATGGGGACGGCTGGG + Intergenic
904619941 1:31769313-31769335 TTGGGGATATGGGGGTTGCTGGG - Intergenic
904842091 1:33379349-33379371 CAGGGGGGATGGGGGGGGCAGGG - Intronic
904978976 1:34480449-34480471 GTGGGGGAATGGGGGTGGGAAGG - Intergenic
905168846 1:36098535-36098557 CTGGGCCTAAGGGTGAGGCAGGG - Exonic
905233967 1:36532950-36532972 CTGGGTGTGTGGGGGTGGAAAGG - Intergenic
905405937 1:37732423-37732445 CTGGGGCTGTGGATATGGCAGGG - Intronic
905804531 1:40866156-40866178 GTGGGGCTAGGAGGGTAGCAGGG + Intergenic
906143510 1:43547091-43547113 CTGGGGGCCTGGGGGTGGGAGGG - Intronic
906509272 1:46401561-46401583 CTGTGGGTGTGGGGATGGCATGG + Intronic
906523440 1:46480216-46480238 CTGGGGCTAGGGGGGTCAGAGGG - Intergenic
907281282 1:53348944-53348966 CAGGAGCTCTGGGGGTGGGAAGG - Intergenic
907524953 1:55048595-55048617 CTGGAGCTGTTGGGCTGGCATGG + Intronic
907927311 1:58966575-58966597 CAGGGGCCATGGGGGTGGGGAGG + Intergenic
908406337 1:63817631-63817653 ATGGGGCTTTGGGGGCTGCAAGG + Intronic
908851014 1:68375779-68375801 CAGGGGCTATGGGGGTGCGTGGG - Intergenic
909792078 1:79692658-79692680 CTGGGACTATGGAGATGGAATGG - Intergenic
911276167 1:95861911-95861933 CTTGGGCTCTGGGAGTGGGAGGG - Intergenic
913986383 1:143569732-143569754 CAGGGGCCAGGGGGCTGGCAGGG - Intergenic
914839719 1:151238454-151238476 CTGGGGAGATGGGGGAGGAAGGG - Intronic
915040898 1:152967532-152967554 CTGGGGCAGTGGGGCTGGGAGGG + Intergenic
915102030 1:153507634-153507656 ATGGGGCTGTGGGAGTGGAAGGG - Intergenic
915346543 1:155200420-155200442 CTGGGGCTGAAGGGGTGGCTGGG - Intronic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
917958604 1:180125211-180125233 CTGGGGCAATGGGGCTGGAGAGG + Intergenic
918241639 1:182625401-182625423 CTGGGGCTAGGAGGGTGGGGAGG - Intergenic
919452404 1:197787731-197787753 CTGGGGCTATGGGGCCAGCCTGG + Intergenic
919726175 1:200885877-200885899 CTGGGCCTATGGCCTTGGCATGG - Intergenic
919920444 1:202163854-202163876 CTAGGGTTTTGGGGGTGGGAAGG - Intergenic
920377520 1:205517105-205517127 CTGGGGCCCTGGGGCTGGCCTGG + Intronic
921121533 1:212141675-212141697 CTGGAGCTAGGGGCGGGGCAGGG - Intergenic
921126387 1:212181744-212181766 GTGGGGAGATGGGGGAGGCAGGG + Intergenic
922620030 1:226983527-226983549 GTGGGGGTATGGGTGAGGCAGGG - Intronic
922780643 1:228249950-228249972 CTTGGGCTCTGGGGAAGGCAGGG - Exonic
922781912 1:228259486-228259508 CTTGGGCTCTGGGGAAGGCAGGG - Exonic
922782483 1:228264101-228264123 CTTGGGCTCTGGGGAAGGCAGGG - Exonic
922886629 1:229025347-229025369 CTGGTCCTCTGGGGGTGACAGGG + Intergenic
1062823004 10:548601-548623 CAAGGGTTATGGGGGTGACATGG + Intronic
1067296911 10:44979872-44979894 CTGGGGCTGGGGGGCTGCCAAGG + Intronic
1067349753 10:45465282-45465304 CTGGGGCTGTTGGGGTTGCATGG - Intronic
1067562313 10:47312521-47312543 CTGGGACTGTGAGGATGGCATGG + Intronic
1067655574 10:48188922-48188944 CAGGGGCTAGGTGGGTGGAATGG + Intronic
1069164492 10:65135237-65135259 GTGGGGATATGGAGGTGGTATGG + Intergenic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1070654060 10:78258962-78258984 TTGGGGCTATTGGGATGGAATGG + Intergenic
1070746519 10:78937081-78937103 ATGGGCATGTGGGGGTGGCAGGG - Intergenic
1070838192 10:79464570-79464592 CTAGGGCAATGGTGGTGGCTGGG - Intergenic
1071486038 10:86103414-86103436 CTGAGGCTGAGAGGGTGGCAGGG - Intronic
1072255069 10:93613309-93613331 CCGGGGGAATGTGGGTGGCAGGG + Intronic
1072554810 10:96506665-96506687 CTGGGGCTGTGTGGATGGCTCGG + Intronic
1073095744 10:100978714-100978736 CTGGGGATTTGGGGGTGGGGTGG - Intronic
1073431735 10:103491654-103491676 CTGGGGCTATGGGCAAAGCAGGG - Intergenic
1073453094 10:103621073-103621095 CTGTGGATATGTGGGTGTCAGGG + Intronic
1073751183 10:106528478-106528500 TTGGGGCTATTGGGATGGAATGG + Intergenic
1074986491 10:118664379-118664401 CTGGGGTTCTGGGGGTAGGATGG + Intergenic
1075471886 10:122697260-122697282 CTGGGTCCATGGGGGTGACTGGG - Intergenic
1076560377 10:131359187-131359209 GTGGGGCTCTGAGGGTGGCGCGG - Intergenic
1076788134 10:132761431-132761453 ATGGAGCTCTGGGGGTGGCAGGG + Intronic
1077108718 11:852922-852944 CTGGGCCTGTGGGGAGGGCATGG + Intronic
1077159215 11:1105059-1105081 CTGGGGCCATGGGGTGGGGAAGG + Intergenic
1077501848 11:2912897-2912919 CCGGTGCCATGGGGGTGCCAGGG + Intronic
1077891893 11:6424594-6424616 ATGGGGGTATGGGAGGGGCAGGG + Intergenic
1078552977 11:12293205-12293227 CTGGGCCTCTGTGGGTGGCCAGG - Intronic
1078922151 11:15840894-15840916 CAGGGGTGATGGGGTTGGCAAGG + Intergenic
1079008730 11:16811326-16811348 CTGGGCCTATGGGAGAGGCCTGG - Intronic
1080622476 11:33998071-33998093 CTGAGAGTATGGGGGTGGCAGGG + Intergenic
1081399564 11:42627047-42627069 CTGGGGCTATAGGGTTGGATAGG - Intergenic
1081992853 11:47346990-47347012 CTGGGTGTTTGGGGGCGGCAGGG - Intronic
1082763473 11:57148421-57148443 CTGGGGGTATGGGGAAGGCAGGG - Intergenic
1083236813 11:61356413-61356435 TTGGGGCTATGGGGGTAGGGTGG - Intronic
1084876854 11:72139517-72139539 GTGGGGCTTTGGGGTTGGGAGGG + Intronic
1084881920 11:72177651-72177673 GTGGGGCTTTGGGGTTGGGAGGG + Intergenic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085637323 11:78168798-78168820 GTGGGGCGGTGGGAGTGGCAGGG + Intergenic
1085767675 11:79297403-79297425 CTGGGACAATGGGCCTGGCAGGG + Intronic
1085883579 11:80496591-80496613 CTGGGGCTATATGGGTACCAGGG + Intergenic
1089204476 11:116748454-116748476 CTGAGGCTGTGGGGGTGGCTGGG - Exonic
1089346121 11:117792857-117792879 CTGGGGATATTGGGGTAGGATGG - Intronic
1089408256 11:118216885-118216907 ATGGGGCAAGGTGGGTGGCACGG - Intronic
1090243566 11:125200525-125200547 CTTGGGCTCAGGGGGCGGCATGG - Intronic
1090352253 11:126115054-126115076 CTGGGGCTATGGAGTAGGGAAGG - Intergenic
1090387045 11:126363398-126363420 CTGGGACTCTGGGGGTGGCTGGG + Intronic
1090640670 11:128726529-128726551 GTGGGGGTAGGGGGGTGGGAGGG - Intronic
1091224293 11:133948489-133948511 CTGGGGCTGTGGGGGAGGTGAGG - Intronic
1091239727 11:134044320-134044342 CAGGGGGAATTGGGGTGGCATGG - Intergenic
1091347594 11:134865478-134865500 GTGGGGCTACGGTGGTGGAAAGG + Intergenic
1091445952 12:544191-544213 CTGAGGCTCTGGGGAGGGCATGG + Intronic
1091610479 12:2003898-2003920 CTGTGGCTATGGGGGAGGCAGGG - Intronic
1092171902 12:6378826-6378848 CTGGGGCTCTGGGGGAGTCTGGG - Intronic
1093776798 12:23084846-23084868 CTGGAGCTATAGGGGTGACTGGG - Intergenic
1095783317 12:46084575-46084597 CTGGGGCTATGTGGAGAGCAAGG + Intergenic
1096202049 12:49691430-49691452 CTAGGGCTATGGCTGTGCCAAGG + Intronic
1096333912 12:50738557-50738579 CTGGGGAGATGGAGGTTGCAGGG - Intronic
1096371942 12:51076138-51076160 CTGGGACTCTGGTGGGGGCAGGG + Intronic
1097181208 12:57173078-57173100 CTGGGCTTACCGGGGTGGCAGGG + Intronic
1098394906 12:70006717-70006739 TTGGGGCAGTGGGTGTGGCATGG - Intergenic
1098396950 12:70029060-70029082 ATGGGGTTAGGGAGGTGGCAGGG + Intergenic
1098534180 12:71576076-71576098 CAGGGCCTATCAGGGTGGCAGGG + Intronic
1099120796 12:78686970-78686992 ATGGGGCCATGGCGGGGGCAGGG - Intergenic
1099395759 12:82136578-82136600 CTTGGACTATGATGGTGGCAGGG - Intergenic
1100300059 12:93298536-93298558 GTGGGGGTAAGGGGGTAGCAAGG + Intergenic
1100588857 12:96005349-96005371 CTGGGGCCATGAAGGTTGCATGG - Intronic
1102072701 12:110035038-110035060 ATGGGGCCATGGTGGTGGCAGGG - Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103913648 12:124365013-124365035 TTGGGGGTATGGAGGTGGCCTGG + Intronic
1103922223 12:124405003-124405025 CGGGGGCTCTGGGGGCAGCAGGG - Intronic
1104717656 12:131026650-131026672 CTGTGGCTGTGGGGCTGGCCTGG + Intronic
1104735550 12:131133970-131133992 CTTGGGGTAGGGGGGTGGCAGGG - Intronic
1106085921 13:26541584-26541606 CTGGGGCTAAGGGTGTTACAGGG - Intergenic
1106411267 13:29513173-29513195 CTGGAGCTATGGGGGTGGGGAGG + Exonic
1108477584 13:50836290-50836312 ATGGAGATATGGGGGTGGGAGGG + Intronic
1109308051 13:60662168-60662190 CTGGGGGGGTGGGGGTGGCAGGG - Intergenic
1110041688 13:70767878-70767900 CTGGGGCTTAGCGGGGGGCAGGG + Intergenic
1113015355 13:105822843-105822865 CTGGGATTATGAGAGTGGCAGGG - Intergenic
1114207187 14:20583189-20583211 CTGGGGCTGTGGGAGAGGAATGG - Intergenic
1114778277 14:25511456-25511478 CTGGGAGTATGAGGGAGGCAGGG - Intergenic
1115469553 14:33754513-33754535 CTGGCTCTATGGCGGTAGCATGG + Intronic
1115475073 14:33805714-33805736 CTGGGGCTGAGGAGGTGGCAGGG - Intergenic
1117374060 14:55104739-55104761 CTGGGGCTGTGGATTTGGCAAGG + Intergenic
1117495369 14:56296866-56296888 CTGGGGCCATCGGAGTGACACGG + Exonic
1118812510 14:69285645-69285667 CTGGGGCTGTGGCAGTCGCATGG + Intronic
1121085416 14:91142543-91142565 CTGGGGCTTAGGTGGGGGCAGGG - Intronic
1121642140 14:95492599-95492621 CTAGGGCTAGGGAGGTGGGAGGG + Intergenic
1121734001 14:96205446-96205468 CTGGCTCCCTGGGGGTGGCAGGG + Intronic
1121823373 14:96990051-96990073 TTGGAGATAAGGGGGTGGCAAGG - Intergenic
1122274850 14:100586303-100586325 CTGGGGGTATGGGTGGGGCGGGG - Intronic
1122300524 14:100728606-100728628 CTGGGGAGATGGGGGGGGCGGGG + Intronic
1122780278 14:104140568-104140590 CTGGGGCCATGGTCCTGGCATGG + Intronic
1122853416 14:104548630-104548652 CTGGGGCTGGGGTGGGGGCAGGG - Intronic
1122956853 14:105075177-105075199 CAGGGGCTGTGGGGGTGGGAGGG - Intergenic
1122956873 14:105075221-105075243 CAGGGGCTGTGGGGGTGGGAGGG - Intergenic
1122956893 14:105075265-105075287 CAGGGGCTGTGGGGGTGGGAGGG - Intergenic
1122956931 14:105075351-105075373 CAGGGGCTGTGGGGGTGGGAGGG - Intergenic
1122965641 14:105123961-105123983 CTGGGGCAATGGGAGTGACCGGG - Intergenic
1123136302 14:106030704-106030726 CTGGGGTTATGGCTGTGGAATGG - Intergenic
1123493517 15:20800528-20800550 CTGGTGCGATGGGGGTGGGCTGG - Intergenic
1123550025 15:21369630-21369652 CTGGCGCGATGGGGGTGGGCTGG - Intergenic
1124369001 15:29092715-29092737 CCGGGGCTGTGGGGAAGGCATGG + Intronic
1124797445 15:32795585-32795607 ATGGGGGTGGGGGGGTGGCAGGG + Intronic
1124942152 15:34228248-34228270 GTGGGGTAATGGTGGTGGCATGG + Intronic
1125254250 15:37744986-37745008 TTGGAGCTGTGGGGGTGGCTAGG - Intergenic
1127103531 15:55589816-55589838 CTGGGACGACTGGGGTGGCAGGG + Intergenic
1127179987 15:56404979-56405001 CTGGCGCTAGGGAGCTGGCAGGG + Intronic
1127496167 15:59514070-59514092 TTGGGGGCATGGGGGGGGCAAGG + Intronic
1128217413 15:65944142-65944164 CTGGGGGTTAGGAGGTGGCAGGG + Intronic
1128523418 15:68390547-68390569 CTGGGGCTGTGGGGGAGGCCAGG - Intronic
1128727151 15:69996644-69996666 CTGGGGCTCAGGGCGTGGGAGGG + Intergenic
1128968527 15:72086006-72086028 CTGGGGGTAGGAGGGTGTCAAGG + Intronic
1129450894 15:75650628-75650650 CTGGGGAGATGGGGATGGCCTGG + Intronic
1129758463 15:78112723-78112745 ATCTGGCTTTGGGGGTGGCAGGG - Intronic
1131028853 15:89169216-89169238 CTTGGGCTTTGGGGTTGACATGG + Intronic
1131199635 15:90386011-90386033 CTTGGGCCTTGGGGGTGGCTGGG - Intergenic
1131966799 15:97852895-97852917 TTGGGGCTGTTGGGGTGGAATGG - Intergenic
1132148437 15:99442772-99442794 CTGGGGTGTTGGGGCTGGCAGGG - Intergenic
1132185295 15:99798140-99798162 CTGGGGCTCTGAGGATGGGATGG + Intergenic
1132431693 15:101766422-101766444 CTGGGGCTCTGAGGATGGGATGG - Intergenic
1202958355 15_KI270727v1_random:96848-96870 CTGGCGCGATGGGGGTGGGCTGG - Intergenic
1132505099 16:304086-304108 CTGGGCCTCTGAGGGTGGCATGG + Intronic
1132517465 16:372466-372488 CTGGGCCTCTGTGGGTGCCATGG + Intronic
1132694351 16:1195297-1195319 CTGGGGCTCAGGGCGGGGCAGGG + Intronic
1132727595 16:1345616-1345638 CTGGGGTTGTGGGGGAGGCTGGG - Intronic
1132985878 16:2767386-2767408 CTGGGGCTGTGGGAGTGCGAGGG - Exonic
1132990008 16:2787498-2787520 CAGGGGCTGTGGGGGCTGCAGGG - Intronic
1133028184 16:2997649-2997671 CAGGGTCTGTGGGGGCGGCATGG - Intergenic
1133300250 16:4778046-4778068 CTGGGGCTAGGGGGCTGGCGAGG - Intronic
1134208939 16:12259910-12259932 CGGGGGATTAGGGGGTGGCAGGG - Intronic
1134849534 16:17469566-17469588 CTGGGGCCATCTGGGTGGCTGGG - Intronic
1135853289 16:25983850-25983872 GTGGGGCTGTGGGGGTTGCATGG + Intronic
1136590292 16:31214423-31214445 CTGGGGCTAAGGCGAGGGCAAGG + Intronic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1137274235 16:46923087-46923109 CTGGGGCTAAGGGGAGGGCAGGG - Intronic
1137387014 16:48051167-48051189 ATGGGGCTATGGGGGTGGAAAGG - Intergenic
1137703502 16:50517589-50517611 CTGGGTCTATGGGGCAGGCCTGG + Intergenic
1137703622 16:50518033-50518055 CTGGGGCCATGGGTCTGGCCTGG + Intergenic
1138516912 16:57541224-57541246 GAGGGGCTATGGGGTAGGCAGGG + Intergenic
1138624542 16:58238708-58238730 CTTGGGATATGGAGGGGGCAGGG - Intronic
1139198120 16:64944697-64944719 CTGGGTTTCTGGGGGTGACAGGG - Exonic
1139954090 16:70685192-70685214 CTGGGGCTGTGGGGGTGGGGCGG + Intronic
1140281167 16:73556585-73556607 CTGGGGTTTTCAGGGTGGCAGGG + Intergenic
1140466054 16:75183801-75183823 CAGGGGCTAGGGGTGTGGGAGGG + Intergenic
1140813352 16:78599402-78599424 CTTAGGCTATGGCGGGGGCAGGG - Intronic
1141358624 16:83373534-83373556 CATAGGCTATGGGGATGGCAGGG + Intronic
1141694640 16:85613708-85613730 GTGGGGGGATGGGGGTGGCGGGG + Intronic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142233156 16:88909200-88909222 CTGGGGCTGTGGTGCAGGCAGGG + Intronic
1142245212 16:88967208-88967230 CGGGGGCTGGGGGGGTGGCATGG - Intronic
1142352826 16:89587700-89587722 GGGGTGCTATGGGGGTGACACGG - Intronic
1143269679 17:5666340-5666362 CTGGGGGTGGTGGGGTGGCAGGG - Intergenic
1145266542 17:21382375-21382397 CTGAGGGGATGGGGCTGGCAGGG + Intronic
1145274911 17:21423471-21423493 CTGTGGCTATGGTGGAGGCCGGG - Intergenic
1145312764 17:21709370-21709392 CTGTGGCTATGGTGGAGGCCGGG - Intergenic
1146012849 17:29209438-29209460 CTAGGGCTTTGGGGAGGGCAAGG - Intergenic
1146647041 17:34582436-34582458 CTGGGGCTAGGAGGGGGGCGGGG + Intronic
1146791623 17:35753822-35753844 CTGTGGCCATGGGGGTGGTAGGG - Intronic
1147006944 17:37410949-37410971 ATGGGGCACTGAGGGTGGCAGGG - Intronic
1147132944 17:38419538-38419560 CGGGGGCTCTGGGGGAGGGATGG + Intergenic
1147243456 17:39105763-39105785 CTGGGGGGATGGCAGTGGCAGGG - Intronic
1147428607 17:40357753-40357775 CTGGGGCCAAGGGGCTGGCCAGG + Intergenic
1147568372 17:41551646-41551668 CTGGGGCTTGGGGGCTGGCATGG + Intergenic
1147708033 17:42441552-42441574 CTGGGGTGTTGGGGGTGGCAGGG - Intergenic
1147760475 17:42794875-42794897 CTGGGGAAATGGGGGTTCCAGGG - Exonic
1148168923 17:45503368-45503390 CTGCTGCTATGGGGGAGGAAAGG - Intergenic
1148279894 17:46339645-46339667 CTGCTGCTATGGGGGAGGAAAGG + Exonic
1148302112 17:46557501-46557523 CTGCTGCTATGGGGGAGGAAAGG + Exonic
1149342788 17:55703696-55703718 CTGTGGCCATGGGGCTGGCTGGG + Intergenic
1150137050 17:62701865-62701887 CTGTGGCCATGTGGGTGGCTGGG - Intronic
1150400118 17:64849829-64849851 CTGCTGCTATGGGGGAGGAAAGG - Intergenic
1150922964 17:69502705-69502727 GGGGGGCTGTGGGGGTGGCTGGG + Intronic
1151447725 17:74178108-74178130 ATGGGGATATGGGCATGGCAGGG - Intergenic
1151843685 17:76636239-76636261 CTGGAGGTATGGGGGTGGGGTGG - Intronic
1152210445 17:79000450-79000472 CGGGGGGTATGGGAGTGTCAGGG - Intronic
1152279789 17:79378608-79378630 CTGGGGCTGTGTGGGGGGCCCGG + Intronic
1152570803 17:81120509-81120531 GTGGGGCTCTGGGGGTGCCTGGG + Exonic
1153098004 18:1431029-1431051 ATGGGGATATGGGGGTGGATGGG + Intergenic
1153804107 18:8696995-8697017 GTGGGGCTCTGGGGCTGGCAGGG - Intergenic
1153873718 18:9345891-9345913 CTGGGGATATGTGGGGGGAATGG - Intronic
1154176147 18:12088073-12088095 CTGGGGCTAGGACGGTGACAGGG - Intergenic
1155062695 18:22242627-22242649 CTGGGAATCTGGGGGTGGCTCGG + Intergenic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1156449453 18:37258782-37258804 CTGGGGGAATGGGTGTGGCTGGG + Intronic
1157183955 18:45522415-45522437 CTGCCGCTCTGGGGATGGCAGGG - Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157566012 18:48679846-48679868 CTGGGCCTTGGGGGGTGGCCTGG + Intronic
1158631470 18:59118821-59118843 TTGAGGGTGTGGGGGTGGCAGGG - Intergenic
1160488664 18:79318377-79318399 CTGGGGCTGTGGGGCTGGGGAGG - Intronic
1160827916 19:1089310-1089332 CTGGGGGTCTGGGGGTGTCCTGG + Intronic
1160970107 19:1764256-1764278 GTGGGGGCATGGGGGTGTCAGGG - Intronic
1161453065 19:4357431-4357453 ATGGGGCTGTGGGGGGAGCAAGG + Intronic
1161528801 19:4774247-4774269 CTGGGTCCTTGGGGGTGGCTGGG - Intergenic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1161668361 19:5590442-5590464 GTGGGCCTATGTGGGTGACATGG - Intronic
1161808534 19:6458878-6458900 CTGGGGCTACAGGTGTGGGAAGG + Intronic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162419088 19:10555636-10555658 CTGAGGCTTTGGGGATGGCCGGG - Intronic
1162568639 19:11458031-11458053 CTGGGGCCATCTGGCTGGCAGGG + Intronic
1162740879 19:12772913-12772935 CTGGGGAGAAGGGGGTGTCAGGG + Intronic
1162796361 19:13089589-13089611 CTTGGGCCCAGGGGGTGGCAAGG - Intronic
1163270843 19:16252554-16252576 CTGGGGCTGTGAGGAGGGCACGG + Intergenic
1163638870 19:18450489-18450511 CTGGGGCTCCGGGGGTGGCATGG + Exonic
1164137342 19:22427181-22427203 TTGAGGCTAAGGGGGTGGCGGGG + Intronic
1164449734 19:28350512-28350534 CTGGGTCTATGGGGCTGGCCTGG - Intergenic
1165444183 19:35848006-35848028 CCAGGGCTATGGGGGTGGCCAGG - Intronic
1166054556 19:40280595-40280617 CTGGGGCTGCGGGGCAGGCAGGG - Intronic
1166071365 19:40390055-40390077 CTGGGGGTTTGGGGGTGCCAGGG - Exonic
1166190365 19:41172816-41172838 CTGGGGCTGTGGGGGAGGTGGGG - Intergenic
1166347369 19:42175149-42175171 CTGGGGCTCTGGGAGGGGGAGGG - Intronic
1166740687 19:45113103-45113125 CTGGGGATGTGCGGCTGGCAGGG + Intronic
1166755327 19:45187233-45187255 CTGGGGCCATGGGAGGGACAGGG + Intronic
1166790340 19:45395503-45395525 CTGGGGCTGTGGGGGCAGCTGGG + Exonic
1166974955 19:46600645-46600667 CTGGGCCTTTGGAGGTGGCGGGG - Intronic
1167146874 19:47686386-47686408 CTGGGGTTAGCGGGGAGGCATGG + Intronic
1167291576 19:48627917-48627939 CTGGGTCTATGGGGCTGGGGTGG + Intronic
1167455711 19:49595958-49595980 CTCGGGCCATGGGGGTGGCTGGG + Exonic
1167456949 19:49601476-49601498 CGGGGGCTCTGGGGGAGACAGGG - Exonic
1167538770 19:50072302-50072324 CTGGGGCCGTGGGGATGGTAAGG + Intergenic
1167579376 19:50332848-50332870 CTGGGGTAATGGGGGAGGGAGGG - Intronic
1167638182 19:50667147-50667169 CAGGGGGTAACGGGGTGGCAGGG + Exonic
1168354004 19:55691187-55691209 GTGGGGCAATGGGCGTGGGAAGG + Intronic
1202713146 1_KI270714v1_random:28232-28254 CTGGGGCTGTGGGGGTGGGGGGG + Intergenic
925416430 2:3673044-3673066 CTGGGGGAATTGGGGTGGGAGGG + Intronic
926703504 2:15819891-15819913 CTGGGGCTGTGGGAGGGGCAAGG + Intergenic
926751045 2:16198799-16198821 CTGGGGTAATGGGGGAGGCATGG + Intergenic
927486142 2:23489650-23489672 ATGGGGGCATGGTGGTGGCAAGG + Intronic
927641734 2:24849801-24849823 CTGAGGCTTGGGGGGTGGCAGGG - Intronic
927847043 2:26477044-26477066 CTGGGGGTTGGGGGGTGGCCAGG + Intronic
929670938 2:43876061-43876083 CTGATCCTATGGAGGTGGCATGG - Intronic
929759881 2:44798151-44798173 CTGGGGCCATTGCAGTGGCAAGG - Intergenic
929818603 2:45256302-45256324 TTGGTGCTATGGGGTTGTCAGGG + Intergenic
929820232 2:45267407-45267429 CTGGGGTGATGGGCGTGGCTCGG - Intergenic
930186245 2:48415100-48415122 CTGTTGATATGGGGGAGGCAGGG + Intergenic
930570820 2:53084626-53084648 CTGGGGATTTGGTGGTGGGAAGG + Intergenic
930607815 2:53510539-53510561 CTGGGGCTGTGGAGCTGGCTGGG - Intergenic
931571724 2:63675517-63675539 CGCGGGGTAGGGGGGTGGCAAGG + Intronic
931787041 2:65629480-65629502 CTCAGGCTATGCTGGTGGCAGGG + Intergenic
932440474 2:71731488-71731510 CTGAGTCTATGGGGCAGGCAAGG - Intergenic
933512718 2:83261743-83261765 CTGGGGGTGTGGTGGTGGCGGGG + Intergenic
933899101 2:86836410-86836432 CTGGGACTAGGGGTGCGGCATGG - Intronic
934557840 2:95296822-95296844 CTGGGGCAGTGGGGGTGTCCTGG + Intergenic
935781452 2:106512816-106512838 CTGGGACTAGGGGTGCGGCATGG + Intergenic
937276167 2:120685533-120685555 CTGGGGCTGTGGGTGTGGCTGGG - Intergenic
937527966 2:122794324-122794346 CTGAGGGTGTGGGAGTGGCAGGG + Intergenic
937929595 2:127193760-127193782 TTGGGGCCATGGGGGTGGCCAGG - Intronic
937986376 2:127639951-127639973 CTGGGGATATGGTGGGGACAAGG - Intronic
941247044 2:163111781-163111803 CTGGGGCTATGGGTGGGGGTGGG - Intergenic
941446266 2:165603601-165603623 ATGGGGCAATTGGTGTGGCATGG - Intronic
943840127 2:192569921-192569943 CAGGGGTTATGGGGGAGGGAGGG - Intergenic
944294857 2:198050406-198050428 CTGGGGTTGTGGGGAGGGCAGGG + Intronic
944417531 2:199493536-199493558 CTTGGACTAGGAGGGTGGCAGGG + Intergenic
946750447 2:222890239-222890261 CTGGGCTTTTGGGGGTGGGAAGG + Intronic
948458290 2:238117343-238117365 CTGGGGCCATGGCTGTGGCCAGG + Intronic
948807999 2:240461221-240461243 CTGGGGCTTCAGGGCTGGCAGGG - Intronic
1169060663 20:2658436-2658458 CAGGGCCTATGGGTGGGGCAAGG + Exonic
1169131312 20:3167606-3167628 CTGGGGAAATGGGGTTGGAAGGG + Intronic
1169251224 20:4062892-4062914 CTGGGCCAATGGGGGTGCCTGGG + Intergenic
1169638504 20:7721673-7721695 CTGAGGCTATGGGGATGGGTAGG - Intergenic
1170527006 20:17248958-17248980 CTGTGGCTCAGGGGGTGCCAGGG - Intronic
1170692139 20:18625475-18625497 CTGGGGCACTGGGGATGCCAAGG + Intronic
1171168512 20:22994462-22994484 CTGGGGCTGTGTGGGTGTCTGGG + Intergenic
1171220692 20:23394194-23394216 ATGGGGATGTGGGGTTGGCAAGG + Intronic
1171532327 20:25860876-25860898 CTGGGGCTGTGGCTGTGGCTGGG - Intronic
1171532654 20:25862552-25862574 CTGGGGCTGTGGCTGTGGCTGGG - Intronic
1171533386 20:25866560-25866582 CTGGGACCCGGGGGGTGGCAGGG + Intronic
1172176085 20:32972706-32972728 CTGGGGGTCTGGGTGTGGGATGG + Intergenic
1172443507 20:34981067-34981089 GTGGGGCTCTGGGGGTGGGGTGG + Intronic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1172705567 20:36879759-36879781 CTGGGGCCAGGGGTGTTGCAGGG + Intronic
1172883589 20:38217185-38217207 CTGGGGCTATGGTGGGGACAGGG - Intronic
1172985674 20:38986984-38987006 CTGGGGCTGCTGGGGTGGAAAGG + Intronic
1173252852 20:41373819-41373841 CTGGGGCTCTGGGTGTGGGAAGG + Intergenic
1173605366 20:44327351-44327373 CTTGGGGGATGGGGGTGGGAAGG - Intergenic
1174036612 20:47672453-47672475 CAGGGTGGATGGGGGTGGCAGGG - Intronic
1174077221 20:47946247-47946269 TTGAGCCTGTGGGGGTGGCAGGG + Intergenic
1174103728 20:48147259-48147281 CTGGGGTGATGGGGCTGGGATGG + Intergenic
1174260626 20:49292257-49292279 CTGAGACTATGGGTGTGGCTGGG - Intergenic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1174453033 20:50631321-50631343 CTGGAGTTATGGGGGTCCCAGGG + Intronic
1174691409 20:52510257-52510279 CTGGGGGTGTGGGGGTGGTGAGG - Intergenic
1175275229 20:57763926-57763948 CTTGGACTATGGTGGTTGCATGG + Intergenic
1175781310 20:61684006-61684028 CTGGGGAGGTGGGCGTGGCAGGG + Intronic
1176146798 20:63569083-63569105 CTGGGGCAATGGGAGCGGCTGGG - Intronic
1178375327 21:32062080-32062102 CTGGGGATTTGGGAGTGGAAAGG + Intergenic
1178404988 21:32316608-32316630 GTGGGGCTGAGGGGCTGGCAGGG - Exonic
1179215585 21:39364471-39364493 GTGGGGCTGTAGGGGAGGCAAGG + Intergenic
1179640732 21:42745778-42745800 CTGGGGCTGCGGGTGTAGCAGGG + Intronic
1179880996 21:44293299-44293321 CTGGGGCTGTGGGGGGAGCGTGG + Intronic
1180004824 21:45015500-45015522 TGGGGGCTGTGGGGGTGACAAGG - Intergenic
1180022294 21:45136054-45136076 CTGGGCCCATGGGGGTGGGAGGG + Intronic
1180174273 21:46080163-46080185 GAGGTGCTGTGGGGGTGGCATGG + Intergenic
1180560028 22:16608852-16608874 CTAGGGCTCTCGGGGTGGCCTGG + Intergenic
1181106524 22:20579029-20579051 CGGGGGCCCAGGGGGTGGCATGG + Intronic
1181865179 22:25849016-25849038 CTGCGGCTGTGCGGGTGGGAGGG - Intronic
1181960712 22:26619816-26619838 CTGGGGCTTTAGGGGGGGCACGG - Intergenic
1182122369 22:27796453-27796475 CTGGGGGTGTGGGGGCGGCTGGG + Intronic
1182182042 22:28359839-28359861 CTGGGGATGTGAGAGTGGCAGGG + Intronic
1182753565 22:32660549-32660571 CTGGGGTTAAGGGGCTGGCGGGG + Intronic
1183341471 22:37284116-37284138 CCGGGGCTATGGAGAGGGCAGGG + Intronic
1183605151 22:38863706-38863728 CTGGGCCCCTGGGGGTGGCTGGG - Exonic
1183649566 22:39146018-39146040 CTGGGGCTTGGGGGTTGGCCTGG - Intronic
1184117742 22:42431915-42431937 CTGGGGCCAGGGGCGGGGCAGGG - Intronic
1184252690 22:43269707-43269729 CTGGAGCCTTGGGGGTGGCAGGG + Intronic
1184656458 22:45944347-45944369 GAGGGGCTATGGCAGTGGCAGGG - Intronic
1184669723 22:46006409-46006431 CTGGGGCCATGGGTGTCGTAGGG - Intergenic
1184678499 22:46056260-46056282 CTGGGGAAATGGGGGCTGCAGGG - Intronic
1185137626 22:49081583-49081605 CTGGGACTGTGTGGGGGGCAGGG + Intergenic
1185215326 22:49596280-49596302 CTAGTGCTATGAGAGTGGCAAGG + Intronic
1185281982 22:49976089-49976111 TTGGGGCCATGGGGCTGCCAGGG + Intergenic
1185341636 22:50293698-50293720 CTGGGGCTAGGGGCGCCGCAGGG - Intronic
949126422 3:450284-450306 CTGTGGCTCTGGCGATGGCATGG + Intergenic
950305898 3:11915235-11915257 CTGTGGCTGTGAGGGAGGCAAGG - Intergenic
950416862 3:12873797-12873819 GTGTGGCTGTGGGGGAGGCAAGG - Intergenic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
952207766 3:31197748-31197770 CTGAGGGTTGGGGGGTGGCAGGG - Intergenic
953231446 3:41068722-41068744 CTGGGGAGATGGGGGTGTCCTGG + Intergenic
953663569 3:44908846-44908868 ATGGTGGTGTGGGGGTGGCAGGG - Intronic
954412628 3:50377692-50377714 TTGGGGCTATGGGTGTGCCTGGG - Intronic
954615664 3:51967673-51967695 GTGGGGCTCTGGGAGTGGCAGGG - Intronic
955195712 3:56802928-56802950 ATGGGTCTATGGGTGTGGCATGG + Intronic
955262494 3:57407299-57407321 CCGGGGGTAGGGAGGTGGCAGGG + Intronic
955363552 3:58293104-58293126 CATGGGCAGTGGGGGTGGCATGG - Intronic
955400840 3:58590405-58590427 CTCAGGCTAAGGTGGTGGCATGG - Intronic
958093909 3:88915383-88915405 ATGTGGCTAAGGGGGTGGTAGGG + Intergenic
959468589 3:106720954-106720976 CTGTGGCTCTGGGGCTGGCCTGG + Intergenic
959952302 3:112193602-112193624 CTCTGGGTATGGGGATGGCATGG + Intronic
961006591 3:123409824-123409846 CTGGGGCTTGGAGGGTGGGAGGG - Intronic
961472727 3:127126437-127126459 GTGGGGCTAAGAGGGTGGAATGG - Intergenic
961556467 3:127699718-127699740 CAGGAGCTATGCAGGTGGCAGGG + Intronic
962853443 3:139324857-139324879 CCAGGGCTTTGGGGGAGGCAGGG + Intronic
963346157 3:144098828-144098850 CTGGCTCTATGGAGCTGGCAGGG + Intergenic
964341072 3:155708938-155708960 CAGGGGCTAAGGGGGAGGGAGGG - Intronic
964804684 3:160595777-160595799 TTGGGGCTATGGGGGTGTGTAGG - Intergenic
966744507 3:183262938-183262960 CTGGGGTTGTTGGGGTGGGAGGG + Intronic
968512313 4:1001111-1001133 GTGGGGGGATGGGGGTGACAAGG + Intronic
968581782 4:1398692-1398714 CTGAGGCTGTGGGGCTGGCTTGG + Intergenic
969188720 4:5499767-5499789 CTGGGGATATGGTGGTGGTGAGG - Exonic
969323236 4:6425686-6425708 CTGTGGTGATGGGGATGGCAGGG - Intronic
969471585 4:7392356-7392378 CAGGGGCTTTGGGGTTGGCTGGG + Intronic
969873372 4:10118072-10118094 TCGGGGCTCTGGGGGTGGGAGGG + Intergenic
970546756 4:17137741-17137763 CTGGGTCCATGGGGTTGGCTTGG - Intergenic
971397111 4:26238796-26238818 CTGGGCAGATGGGGATGGCAGGG + Intronic
972175099 4:36394400-36394422 CTGGGGCTAGGGGTTTTGCAAGG + Intergenic
975111612 4:70634627-70634649 GTGTGTATATGGGGGTGGCATGG - Intronic
975844312 4:78508827-78508849 CTGGGGAAATGAGGGTCGCAGGG - Intronic
976770154 4:88642910-88642932 CGGGGGGTGTGTGGGTGGCAGGG + Intronic
980539578 4:134176838-134176860 GTGGGGGTATGGGGGCGCCAGGG - Intergenic
981296713 4:143140908-143140930 CTGGGGGAAGGGGGGTGGCTGGG + Intergenic
981669713 4:147274159-147274181 CTGGGTCCATGGGGATGGCCTGG + Intergenic
981883541 4:149645710-149645732 CTGGGGCTATGAGTTTGCCAAGG - Intergenic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
984298535 4:177885470-177885492 CTGGGGGTGAGAGGGTGGCAGGG - Intronic
985105498 4:186495600-186495622 ATGGCACTATGGGGCTGGCAAGG + Intronic
985685174 5:1278055-1278077 CTGGGGTCCTGGGGGTGCCAGGG + Intronic
985790846 5:1926273-1926295 CTGGGGCTGTGGCAGGGGCAGGG - Intergenic
985891683 5:2720555-2720577 CTGGGCCTGTGTGGGTGGGAGGG - Intergenic
985984677 5:3504584-3504606 CTGGGAACATGGGGCTGGCATGG + Intergenic
986082616 5:4410014-4410036 CTGCTGCTGTGGTGGTGGCAGGG + Intergenic
986620122 5:9664129-9664151 CTGGGGCGATGAGGGAGGCATGG - Intronic
986739248 5:10691679-10691701 CTGAGGATATGGGGCGGGCAGGG - Intronic
988259571 5:28867180-28867202 CTGGGGCTATGCGGGTTACAGGG + Intergenic
990003684 5:50922365-50922387 CTGGGGCTCTGGGGCTGGGTCGG + Intergenic
990110912 5:52323406-52323428 CTGGGGCTAGGAGTGTGGGAGGG - Intergenic
992015199 5:72568178-72568200 CTGGGGGGTTGGGGGTGGCCTGG - Intergenic
992789726 5:80202449-80202471 CAGGGGCTGTGGGGCTGGGAAGG + Intronic
993968311 5:94385904-94385926 ATTGGGGGATGGGGGTGGCAAGG + Intronic
994109674 5:95987117-95987139 CTGGAGCTGTGGGGGCAGCAAGG - Intergenic
994250652 5:97533061-97533083 CTGGAGTTACGGTGGTGGCAGGG + Intergenic
997061278 5:130506295-130506317 CTGGGGCTATGGGGGAGTTTTGG - Intergenic
997960355 5:138316202-138316224 GTGGGGATATGGGGGTGGTGGGG - Intronic
998394872 5:141811957-141811979 CGGGGGCTAAGGGGGTGGGGGGG + Intergenic
998849304 5:146338689-146338711 TTGGGACTTTTGGGGTGGCATGG + Intronic
999230998 5:150061663-150061685 CAGGGCCTGTGGGGGTTGCAGGG - Intronic
1001286001 5:170424564-170424586 CTGGGGCTAGGGGTGGGGCAGGG + Intronic
1001685288 5:173590144-173590166 AGGGGGCAATGGGGATGGCATGG + Intergenic
1001937035 5:175712642-175712664 TTGGGGCAGTGGGGGTGGCGGGG - Intergenic
1002179229 5:177421551-177421573 CTCTTGCTGTGGGGGTGGCAAGG + Intronic
1002209511 5:177588783-177588805 ATGGCGCTCTGGGGGAGGCAGGG - Intergenic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1003505346 6:6735991-6736013 CTGGTGTTATTGGGGTGGCCAGG + Intergenic
1004323226 6:14649365-14649387 GTGGGGAAATGGGGGTGGGAAGG + Intergenic
1004340965 6:14807023-14807045 CTTGGGCAATGGGGGAGGCTGGG + Intergenic
1004836565 6:19538224-19538246 CTGGGGCGATGGTGGGGGCAGGG - Intergenic
1007715166 6:43851450-43851472 CTGGGGCTGGGGTGGTCGCAGGG + Intergenic
1007741506 6:44012678-44012700 CTGGGGCTAAGAGGGGGTCATGG - Intergenic
1007775378 6:44222019-44222041 CTGGGTCTGTGGGGGTGGCAGGG - Intronic
1007936581 6:45737869-45737891 CTTGGGATGTGGGGGTGGAAGGG - Intergenic
1008658123 6:53637080-53637102 CTGGGGACTTGGTGGTGGCAGGG - Intergenic
1009725273 6:67530134-67530156 CTGGGGCTACTGGGCTTGCATGG + Intergenic
1013419071 6:109949841-109949863 CTGGGACAGTGGGAGTGGCACGG - Intergenic
1016192635 6:141289109-141289131 CTGGGGTTATGGGGCTAGCCTGG + Intergenic
1016452371 6:144196233-144196255 CTATGGGTATGGGAGTGGCAAGG + Intergenic
1016853300 6:148642190-148642212 CAGGGGCTCTGGGAGTGGCGTGG - Intergenic
1016940728 6:149481172-149481194 CTGGGGCTGTCGGGGTGGGAAGG - Intronic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1017774922 6:157673115-157673137 CTGGGGCCATGTGGGTCACACGG - Exonic
1018087244 6:160314058-160314080 CTGGGTCTATGGGGTGGGCCTGG + Intergenic
1019534756 7:1523225-1523247 CTGGGGCTGTTGGGATGGCGGGG - Intergenic
1019558777 7:1645590-1645612 CAGGGGCTGCAGGGGTGGCAGGG + Intergenic
1019612762 7:1945277-1945299 CTGGGGCTGTGGTGGTGGACAGG - Intronic
1019685331 7:2378910-2378932 CTGGGGAACTGGGGTTGGCACGG + Intronic
1020016761 7:4835906-4835928 CTGGGCAGATAGGGGTGGCATGG + Intronic
1021313442 7:19118129-19118151 CTGGGGCTGGGGGGGTGGTGTGG + Intergenic
1024377414 7:48655576-48655598 CTGGGCCTCTGGGTGTGGAAGGG + Intergenic
1024387934 7:48774879-48774901 CTTGGGAAATGGGGGTGGCGGGG - Intergenic
1026737374 7:72957595-72957617 CTGGAGCTATGGGTGTGGAGGGG + Intergenic
1026787575 7:73311593-73311615 CTGGAGCTATGGGTGTGGAGGGG + Intergenic
1027106358 7:75407473-75407495 CTGGAGCTATGGGTGTGGAGGGG - Intronic
1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG + Intergenic
1028009334 7:85620640-85620662 CTGGGGCTTTGGGGGGTGGAGGG + Intergenic
1028615746 7:92764693-92764715 CTGGCACTATGGGGTTTGCAAGG + Intronic
1030299024 7:107956730-107956752 CTGGAGCTGAGGGGGTGACAGGG + Intronic
1030949512 7:115772149-115772171 CAAGGGCTATGGGTGTGGTAAGG - Intergenic
1031817470 7:126455772-126455794 CTGGTGCTATAGAGGTGGAATGG - Intronic
1032000915 7:128264864-128264886 CTGGGGCTATGGGTAGGGCTGGG + Intergenic
1032820643 7:135521182-135521204 CTGGGACTATAGGTGTGCCAGGG - Intergenic
1033461512 7:141551252-141551274 CAGGGACGGTGGGGGTGGCAGGG - Exonic
1034569538 7:151944285-151944307 CTGGGGCTGTGGGGCTGGGGAGG - Intergenic
1034590810 7:152137476-152137498 CTGGGGTGGTGGGGGTTGCAGGG - Intronic
1035093751 7:156335071-156335093 CTGGGTCTAGGAGGCTGGCACGG + Intergenic
1035166582 7:156993967-156993989 GTGGGGCCCTGGGGGTGCCACGG + Intergenic
1035495465 7:159321540-159321562 ATGTAGCTATGGGGGTTGCAAGG + Intergenic
1035684103 8:1510330-1510352 CTGGGGCAACGAGGCTGGCAAGG - Intronic
1035776779 8:2194138-2194160 CTGGGGCTAAGGGCCTGGCTGGG + Intergenic
1037431318 8:18816094-18816116 CTGGGGCTATGGGATTAACAGGG + Intronic
1037777442 8:21844967-21844989 CTGGGGCTTTGGGGAGGGCCTGG - Intergenic
1037925274 8:22839326-22839348 CAGGGGCTTTGGGGGTGGCATGG + Intronic
1038686888 8:29727113-29727135 CTGCTGCTCTGGGGGTGGGAGGG + Intergenic
1038980325 8:32752329-32752351 CTGTGGCTATGGGGGAGGGGAGG + Intronic
1039503002 8:38031459-38031481 CTGGGGCTCCGGGGCTGGGAGGG - Intronic
1044988669 8:97776301-97776323 TTGGGGCGATGGGGGAGGCCAGG + Intronic
1045710949 8:104983253-104983275 GTGTGTCTATGGGGGTGGCAGGG + Intronic
1046993403 8:120486977-120486999 TAGGGGCTATGAGGATGGCAGGG - Intronic
1047705326 8:127493420-127493442 TTGGGGCTATGATAGTGGCAAGG + Intergenic
1048340028 8:133531555-133531577 CTGGGGTCAGGGAGGTGGCAGGG - Intronic
1049190222 8:141283380-141283402 CTGGAGCTTTGGGGCTGGGAGGG - Intronic
1049337784 8:142095789-142095811 CTGGGTCTCTGGGGATGGGATGG - Intergenic
1049362010 8:142216333-142216355 CTGGGGGTGTGGGGCTGGGAAGG + Intronic
1049363436 8:142225142-142225164 CTGGGGGGAGGGGGGAGGCAGGG - Intronic
1049372515 8:142274602-142274624 CTAGGGCTCTGGGAGTGGCGGGG - Intronic
1049499217 8:142952555-142952577 CTGTGGCTGAGGGGGTGGCTGGG + Intergenic
1049563391 8:143324719-143324741 TGGTGGCTATGGTGGTGGCATGG + Intronic
1049697596 8:143991386-143991408 CTGGGGCCATGGGGGTACCCTGG - Exonic
1049773447 8:144394187-144394209 CTGAGGCTCTGGGGGTGGCCGGG - Intronic
1049867514 8:144948392-144948414 CATGGGCGATGGGGGTGACAAGG + Intronic
1051782333 9:20703172-20703194 TTGAGGCTATGGGGGTGGTGGGG + Intronic
1052989741 9:34512225-34512247 CTGGGGTGATTGGGGAGGCAGGG + Intronic
1056121524 9:83493198-83493220 TGGGGGCTATGTTGGTGGCAGGG + Intronic
1056562943 9:87748545-87748567 CTGGGGCAAGGGGGGTGGAAGGG - Intergenic
1057131398 9:92656747-92656769 CTGGGCCGAGGAGGGTGGCATGG - Intronic
1057262473 9:93592882-93592904 CTGGGGCTATGAGGCTGGGATGG - Intronic
1057702677 9:97375220-97375242 CTGGGGTTCTGGGGGGGGAAGGG - Intronic
1057791500 9:98127899-98127921 CTGGGGCTATGTGGGGTGCCTGG - Intronic
1059449420 9:114361048-114361070 CTGAGGCTGGGGAGGTGGCAGGG - Intronic
1059473847 9:114527953-114527975 CTGGGGAGTTGGGGGTGGCTGGG + Intergenic
1059902112 9:118939458-118939480 CAGGGGGTATGGGTGTGGGATGG + Intergenic
1060279493 9:122206395-122206417 CTGGGGCTTGGTGGGCGGCAGGG - Intronic
1060301548 9:122377220-122377242 CTGAGGCTGTGGGGGTGGAGTGG + Intronic
1060756727 9:126219328-126219350 CTGGGACAATGGGGTTGCCATGG - Intergenic
1060767798 9:126308013-126308035 CTGGGGCTGTCGGGTGGGCATGG + Intergenic
1061481159 9:130898332-130898354 GTGGGGTTGTCGGGGTGGCATGG + Intergenic
1061570320 9:131474061-131474083 CTGGGGCTATGGGGGTGGCAGGG - Intronic
1061589356 9:131588710-131588732 ATGGGGCTGTGGGGCTGGCAGGG + Intronic
1061715337 9:132515134-132515156 CTGGGGATGGGGTGGTGGCAAGG - Intronic
1062453788 9:136626511-136626533 GTGGGACTGCGGGGGTGGCAGGG + Intergenic
1062459214 9:136655887-136655909 CTGGGGCTGGGGGGAGGGCAAGG - Intergenic
1062516514 9:136939719-136939741 CCGGGGCGATGGTGGTGACAAGG - Intronic
1062602367 9:137323659-137323681 CTGGAGCTACGGGGGTGTCCAGG - Intronic
1185503977 X:618960-618982 CTGGGGGCGTGGGGGTGGCTGGG + Intergenic
1188995290 X:36877496-36877518 CAGGGGCTTTGGGAGGGGCAGGG + Intergenic
1190061685 X:47215690-47215712 CTGGGGCTGGGGCGGCGGCAGGG - Intergenic
1190302586 X:49065285-49065307 CTGGGGCTGTGGGGCTGGGGTGG - Intronic
1191963153 X:66726065-66726087 CTGGGGCAATGGGGAGGACAAGG - Intergenic
1192342688 X:70277313-70277335 ATTGGACTATGGGGGTGGCATGG + Intronic
1193366850 X:80644421-80644443 CTGGGGGTACGGGGGTGGGCTGG + Intergenic
1194165335 X:90507966-90507988 TTGGTGCTATTGGGATGGCATGG + Intergenic
1196523783 X:116707425-116707447 ATGGGCCTATGGGGGCGGCGGGG - Intergenic
1197181148 X:123538792-123538814 CTGGGTCTATGGGGCCAGCATGG + Intergenic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1199680804 X:150223384-150223406 CTGGGGCTATGGGGGCAGGGAGG - Intergenic
1199872593 X:151912701-151912723 ATGGGGGTATGAGGGTGGCACGG - Intronic
1200216282 X:154369502-154369524 CTGGGGAAAGGGGGGTGGGATGG - Intronic
1200242783 X:154506622-154506644 TGGGGGCTATGGGGGCTGCAGGG - Exonic
1200511604 Y:4085776-4085798 TTGGTGCTATTGGGATGGCATGG + Intergenic
1201771557 Y:17621421-17621443 CTGGGGTTGTGGGGGGGGCAGGG - Intergenic
1201829998 Y:18284565-18284587 CTGGGGTTGTGGGGGGGGCAGGG + Intergenic
1202069144 Y:20972487-20972509 TTGGGGCTATGGGTATTGCAGGG - Intergenic
1202085769 Y:21135199-21135221 CTGGGGATAAGTGGGTGACAGGG - Intergenic
1202142910 Y:21746883-21746905 CTGGGGCTGTGGGTCTTGCATGG - Intergenic
1202143948 Y:21758735-21758757 CTGGGGCTGTGGGTCTTGCATGG + Intergenic