ID: 1061570912

View in Genome Browser
Species Human (GRCh38)
Location 9:131476961-131476983
Sequence GTGGAGAAGCAGAACCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061570912_1061570918 4 Left 1061570912 9:131476961-131476983 CCTAGATGGTTCTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1061570918 9:131476988-131477010 AGGAGACGTGGCCCCACGGTGGG No data
1061570912_1061570914 -8 Left 1061570912 9:131476961-131476983 CCTAGATGGTTCTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1061570914 9:131476976-131476998 TTCTCCACTGTGAGGAGACGTGG No data
1061570912_1061570919 5 Left 1061570912 9:131476961-131476983 CCTAGATGGTTCTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1061570919 9:131476989-131477011 GGAGACGTGGCCCCACGGTGGGG No data
1061570912_1061570924 26 Left 1061570912 9:131476961-131476983 CCTAGATGGTTCTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1061570924 9:131477010-131477032 GGTTGCCACCTCAGCATGGCAGG No data
1061570912_1061570923 22 Left 1061570912 9:131476961-131476983 CCTAGATGGTTCTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1061570923 9:131477006-131477028 GTGGGGTTGCCACCTCAGCATGG No data
1061570912_1061570916 0 Left 1061570912 9:131476961-131476983 CCTAGATGGTTCTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1061570916 9:131476984-131477006 TGTGAGGAGACGTGGCCCCACGG No data
1061570912_1061570917 3 Left 1061570912 9:131476961-131476983 CCTAGATGGTTCTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1061570917 9:131476987-131477009 GAGGAGACGTGGCCCCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061570912 Original CRISPR GTGGAGAAGCAGAACCATCT AGG (reversed) Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
901878780 1:12181824-12181846 GTGGAGAAACAGCACGAGCTGGG - Intronic
905665242 1:39759693-39759715 TTGGAGAAACAGAAAAATCTTGG - Exonic
906543010 1:46602702-46602724 TGGAAGAAGAAGAACCATCTTGG - Intronic
912215595 1:107607536-107607558 GTGGAAAAGGTGAACCATGTAGG - Intronic
916102699 1:161406539-161406561 GTGCAGAAGCAGACCCGTGTCGG + Intergenic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
920098755 1:203503420-203503442 CTGGAGAAACTGAAGCATCTAGG - Intronic
1065730969 10:28709300-28709322 TTGGAGAAGCAGTTCCAGCTGGG + Intergenic
1066495168 10:35935492-35935514 GATGAGAAAGAGAACCATCTGGG - Intergenic
1066647173 10:37621777-37621799 GATGAGAAAGAGAACCATCTGGG + Intergenic
1067208595 10:44240201-44240223 GTGCAGTAGCTGTACCATCTAGG + Intergenic
1069003662 10:63293807-63293829 GTGAAGAAGTGGAGCCATCTGGG - Intronic
1070388192 10:75946108-75946130 CTGGAGAAGGAGCACCATCGTGG + Intronic
1071824444 10:89310773-89310795 GAGGAGAAGCAGAACTGTTTGGG - Intronic
1072170930 10:92861129-92861151 GTGGAGAAGCACAAACATAAGGG - Intronic
1073064525 10:100750265-100750287 GAGGAGAAGCAGCAGCATTTGGG + Intronic
1075894822 10:125985962-125985984 GAGGAGAAGCAGAAACTTCTGGG + Intronic
1077996127 11:7454020-7454042 GTGGGGAAGCTGAGCCCTCTTGG - Intronic
1078076671 11:8168656-8168678 TTCCAGCAGCAGAACCATCTGGG + Intronic
1082035484 11:47642255-47642277 GCGGAGGAGCAGCAGCATCTCGG + Intronic
1084532525 11:69736611-69736633 GTGGAAAAGCAGATCCATGCTGG + Intergenic
1084693202 11:70738877-70738899 GGGGGGCAGCAGAACCCTCTGGG - Intronic
1085218520 11:74852764-74852786 CTGGAAAAGCTGGACCATCTTGG + Intronic
1089367383 11:117929345-117929367 GTCGAGGAGAAGATCCATCTTGG + Exonic
1089655280 11:119942643-119942665 GAGGAGAGCCAGAACCCTCTGGG + Intergenic
1089665192 11:120013793-120013815 CTGGGGACGCAGAACTATCTAGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1091001356 11:131912416-131912438 GAGGAGAAGAAGAAGAATCTTGG + Intronic
1091325411 11:134683313-134683335 GTGGATAAGCACAATTATCTGGG + Intergenic
1092634278 12:10424465-10424487 GTGTAGTAGCTGTACCATCTAGG - Intronic
1092635324 12:10439869-10439891 GTGTAGTAGCTGTACCATCTAGG - Intronic
1093029364 12:14273976-14273998 GTGGACAAGCTGAACCCACTGGG + Intergenic
1093135051 12:15439856-15439878 GTGCAGAAGCAGACCCACGTCGG + Intronic
1093763841 12:22939989-22940011 GTGCAGCAGCAGCACAATCTTGG + Intergenic
1094187573 12:27661484-27661506 GTGGATAACAAGAACCAACTGGG - Intronic
1095345866 12:41148149-41148171 CTGCAGAAGCAGAACCCTCATGG - Intergenic
1100891007 12:99125787-99125809 GTGGATAAGAAGAAGAATCTGGG + Intronic
1101257015 12:102988701-102988723 TTAGAGAACCAGCACCATCTGGG - Intergenic
1101782506 12:107848471-107848493 GAGCAGAAGCATCACCATCTTGG + Intergenic
1102200783 12:111056336-111056358 GGGGACAAGCTGAACCAACTGGG - Intronic
1105438515 13:20397117-20397139 GTGGACATGCAGAAAGATCTTGG + Intergenic
1105678030 13:22696342-22696364 ATGGAGCTGCAGAACCAACTAGG - Intergenic
1108959327 13:56203859-56203881 GTGGAGAAGGGAAACCTTCTGGG - Intergenic
1115992818 14:39167018-39167040 GTGGGGAAGAAGAACCCACTGGG + Intronic
1119981774 14:79089757-79089779 GTGCAGAAGAAGAAAGATCTTGG - Intronic
1120016642 14:79481622-79481644 GTGGACAAACAGAACCCACTGGG - Intronic
1120829507 14:88985694-88985716 GTGTTGAAGCAGAACCCTGTAGG + Intergenic
1121332353 14:93057692-93057714 GAGGAGAGGCAGAACCAGCAGGG + Intronic
1121427404 14:93862321-93862343 ATGGAGAGGCAAAACCTTCTTGG + Intergenic
1121448785 14:93994934-93994956 GTCAAGATCCAGAACCATCTGGG - Intergenic
1122736517 14:103847034-103847056 GGGGAGAAGCAGATGCATTTGGG - Intronic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1128606947 15:69043634-69043656 TAGGAGAAGCAGAACGTTCTCGG + Intronic
1130274709 15:82470308-82470330 CTGGAGAGGGAGAACCATGTAGG + Intergenic
1130467054 15:84197682-84197704 CTGGAGAGGGAGAACCATGTAGG + Intergenic
1130486549 15:84401495-84401517 CTGGAGAGGGAGAACCATGTAGG - Intergenic
1130497210 15:84475854-84475876 CTGGAGAGGGAGAACCATGTAGG - Intergenic
1130589353 15:85202275-85202297 CTGGAGAGGGAGAACCATGTAGG + Intergenic
1131142921 15:89992301-89992323 ATGCAGCAGCAGCACCATCTGGG - Intergenic
1131539834 15:93266740-93266762 AATGAGAAGCAGAAACATCTAGG - Intergenic
1131804590 15:96108231-96108253 GTTGAGTTGCAGAAACATCTGGG - Intergenic
1132377084 15:101335834-101335856 GTGGAGTAGGGGTACCATCTAGG - Intronic
1132545646 16:531807-531829 GTGGCCAAGCAGAAGCCTCTGGG - Intronic
1132906521 16:2285354-2285376 GTGCAGAACCGGAACCAGCTGGG - Intronic
1133902588 16:9991298-9991320 GTGGAGAACCAGTTCAATCTTGG + Intronic
1135165385 16:20134477-20134499 GTGGAGCAGCAGATCCAGATTGG + Intergenic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1137030800 16:35522429-35522451 GTGCAGAAGCAAAAACATATTGG + Intergenic
1138046532 16:53731304-53731326 CTGGAGAAGCAGATCCCTATAGG - Intronic
1139954994 16:70688911-70688933 TTGGAGGAGCAGATCCATGTGGG + Intronic
1141874977 16:86818036-86818058 GTGCAAAAGCAGAAGCTTCTAGG + Intergenic
1142363289 16:89637210-89637232 GTGAAGGAGCTGAACCGTCTGGG + Exonic
1144959332 17:19036015-19036037 CTGATGAAGCGGAACCATCTGGG - Exonic
1144975827 17:19138509-19138531 CTGATGAAGCGGAACCATCTGGG + Exonic
1148262935 17:46199917-46199939 GTGGAGAAGACCAACAATCTTGG - Intronic
1150249783 17:63699324-63699346 GTGGAGAAGCGGCACCCGCTGGG + Exonic
1150268218 17:63844619-63844641 GTGGAGAATCAGAGTCCTCTGGG + Intergenic
1150437337 17:65164253-65164275 CAGAAGAAGCAGCACCATCTGGG + Intronic
1153522959 18:5969168-5969190 GGGGAGGTGCAAAACCATCTGGG + Intronic
1154020675 18:10661868-10661890 GAGGAGAAGCAGAAGCCTTTGGG + Intergenic
1154126822 18:11699243-11699265 CTGGAGCAGTAGTACCATCTTGG + Intronic
1156903753 18:42330828-42330850 GTGGAGAAGAAAAAACATTTTGG + Intergenic
1157741246 18:50095432-50095454 GTGGAGAAGCAGAAATGTCACGG - Intronic
1160139789 18:76311239-76311261 CTGGAGAAGCAGACACAGCTCGG - Intergenic
1160406079 18:78647131-78647153 GTGGAGAAGAAGAGACATCAGGG + Intergenic
1161020624 19:2009495-2009517 GTCTAGAAGTAGAACAATCTGGG - Intronic
1162179179 19:8855646-8855668 GTGGAGGAGCAATACCATCTAGG + Intronic
1165561322 19:36682656-36682678 GGGGAGCAGCGGCACCATCTTGG + Intergenic
1168104231 19:54156844-54156866 CGGGAGATGCAGAAGCATCTGGG - Exonic
927804211 2:26131208-26131230 GTGGAGAAGAAGAATTGTCTTGG + Intronic
929028582 2:37629425-37629447 CTGGAGTAGCAGTGCCATCTGGG + Intergenic
932193425 2:69761570-69761592 GTGGAGTAGCAGAAGCATCACGG - Intronic
933581331 2:84130046-84130068 GTATAGACTCAGAACCATCTAGG - Intergenic
934055242 2:88246070-88246092 GTGGAGAAACAGAAACATGGAGG - Intergenic
936294089 2:111252090-111252112 CTGGAGAAGCAGAATCAACTGGG - Intergenic
944314309 2:198268953-198268975 CCAGAGAAGCAGAACCAGCTGGG - Intronic
948525095 2:238566523-238566545 GTGGAGAAGGAGAAGCGTCGGGG + Intergenic
948860206 2:240749293-240749315 GTGGAGAATATGAGCCATCTCGG + Intronic
1169691027 20:8332267-8332289 ATGCAGAAGCAGAGGCATCTGGG - Intronic
1170404714 20:16023934-16023956 GTGGAGAAGTAGAAAAATGTAGG + Intronic
1173302713 20:41818092-41818114 GGGCAGAAGCAGAAGGATCTCGG - Intergenic
1173463882 20:43266064-43266086 GTGGGGAAGCAGGACCTTGTGGG - Intergenic
1173705553 20:45107912-45107934 GAGGGGAAGGAGAACTATCTGGG - Intergenic
1174008195 20:47427331-47427353 GTGGGGAAGGAGAACCCACTGGG + Intergenic
1174420391 20:50395601-50395623 CTGGAGAAGCAGAACCACCCTGG - Intergenic
1174848761 20:53970380-53970402 GTGGAAATCCAGAACAATCTTGG + Intronic
1175341150 20:58229725-58229747 GAGGGGAAACAGAACAATCTTGG + Intergenic
1175486609 20:59351424-59351446 GTGGAGTCCAAGAACCATCTGGG + Intergenic
1175683140 20:61005948-61005970 GGGGAGAAGCAGAACCATTAGGG + Intergenic
1177858995 21:26430577-26430599 GTGGAGAAGCAGGAAAACCTGGG - Intergenic
1178302419 21:31464214-31464236 GCAGAGGAGCAGAACCATCCAGG + Intronic
1179143511 21:38748139-38748161 ATGGAGAAGCAGAACCCACCAGG - Intergenic
1183283704 22:36949090-36949112 GAGCAGAAGCATCACCATCTTGG - Intergenic
1183286026 22:36964586-36964608 GTGGAGCAGAAGAACCACCCAGG + Intergenic
1183331740 22:37225997-37226019 CTGGAGGATCAGACCCATCTAGG + Exonic
1184298493 22:43541217-43541239 GTGGAGACCCAGAAGCAACTCGG - Intronic
1184625699 22:45726979-45727001 CTAGAGAAACAGAACCAACTAGG - Intronic
951120093 3:18916545-18916567 GAGTAGAAGGAGAACCATTTTGG + Intergenic
953988291 3:47462841-47462863 GCTGAGAAGCACAACCTTCTAGG - Intronic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
955167890 3:56532961-56532983 GTGTAGAAGCAGAGACATATGGG - Intergenic
955397390 3:58566787-58566809 GTGGGGAAACAGAACCAACCTGG + Intronic
957464382 3:80567537-80567559 GTGGAAATACAGAAACATCTGGG + Intergenic
959242659 3:103817626-103817648 GTGTACAAGTAGACCCATCTTGG - Intergenic
961824146 3:129589994-129590016 GTGGAGACGCAGAGCCAGCCGGG - Intronic
962411388 3:135144173-135144195 GTGCAGAACCAGAAACAGCTGGG - Intronic
963052240 3:141152109-141152131 GTTGAGCATTAGAACCATCTAGG - Intergenic
963443223 3:145367758-145367780 ATGGTGAAGCAGAACCTTCTGGG - Intergenic
963855347 3:150247707-150247729 GGGGAAAGGCAGATCCATCTTGG + Intergenic
967516639 3:190377179-190377201 GAGGAAAAGAAGAACCAGCTTGG + Intronic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
969362163 4:6671915-6671937 GTGGTGAATCAGACCCACCTTGG + Intergenic
969655259 4:8493587-8493609 GTGGGCAAGGAGAACCCTCTGGG + Intergenic
970558300 4:17257789-17257811 CTGGAGAAGGAGAACAACCTGGG - Intergenic
971231783 4:24806144-24806166 GTGGAACAGAAGAACCATGTTGG + Exonic
971897449 4:32616089-32616111 GTGGAGAAGCAGATATCTCTGGG - Intergenic
975003430 4:69255752-69255774 GTGCAGCAGCAGCACCATCTTGG - Intergenic
975011720 4:69363117-69363139 GTGCAGCAGCAACACCATCTCGG - Intronic
977050141 4:92119382-92119404 CTGCAGAAGCAGAACCCTCATGG + Intergenic
978971412 4:114811637-114811659 GAGGAGAAGCAGAACCCTGGAGG - Intergenic
979091620 4:116490257-116490279 GCAGATAAGCAGAACCTTCTAGG + Intergenic
979091906 4:116493770-116493792 GTGGAAAAGCATAACCAAGTTGG + Intergenic
980101311 4:128543897-128543919 GTGCTGAAGCAGAACCAACATGG - Intergenic
980595786 4:134952713-134952735 GTGCAGAAGCAGACCCATGCTGG - Intergenic
984870540 4:184320979-184321001 GTGGTGAATCAGAAATATCTAGG + Intergenic
985266344 4:188154972-188154994 GTGGAGAAGCAGATTCCGCTTGG - Intergenic
986250937 5:6058232-6058254 GTGGAGAAGCAGCACGGGCTTGG - Intergenic
987379522 5:17272013-17272035 GTGCAGCAGCAGCACAATCTCGG - Intronic
989327930 5:40221836-40221858 GTGGAGAAGCAGAGTCTTCCAGG + Intergenic
990328278 5:54699348-54699370 ATGGAGAAGAATCACCATCTTGG - Intergenic
993586734 5:89740294-89740316 TTGGAGCACAAGAACCATCTTGG - Intergenic
995233452 5:109798212-109798234 GTGGAGAGGCAGGAGCATATAGG + Intronic
996808720 5:127489041-127489063 GTGGGCAAGCATTACCATCTGGG - Intergenic
996991487 5:129637792-129637814 GTGCAGTAGCACAATCATCTTGG - Intronic
998143605 5:139713171-139713193 TTGGAGAACCAGAGACATCTGGG - Intergenic
998808607 5:145942736-145942758 GTGAAGCTGGAGAACCATCTGGG - Intronic
999160651 5:149494295-149494317 GAGGATAAGCACAACCATATGGG + Intronic
999239393 5:150118774-150118796 CTCGAGAAGCAGCACCAGCTGGG + Exonic
1000524437 5:162339083-162339105 AAGGACATGCAGAACCATCTGGG - Intergenic
1000575929 5:162975350-162975372 GGAGAGCAGCAGAGCCATCTTGG + Intergenic
1001180369 5:169514466-169514488 GTGTAGCATCAGAAGCATCTTGG + Intergenic
1003142421 6:3482555-3482577 GTGGAGAAGGGGAAACAACTGGG - Intergenic
1004272611 6:14209417-14209439 TTGGAGAAGCATAACCATTAAGG + Intergenic
1004274516 6:14223488-14223510 GTGGAGAAGATGATCTATCTTGG + Intergenic
1005034721 6:21545130-21545152 GTGGGCAAGGAGAACCAGCTGGG - Intergenic
1005484868 6:26290147-26290169 GTGTAGAAGCAAAAACATGTCGG - Intergenic
1006371849 6:33649743-33649765 ATTGAGCAGCAGAACCATGTGGG + Intronic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1009824981 6:68856458-68856480 GTGGAGATGCAGAACTTTTTGGG + Intronic
1013862518 6:114652805-114652827 GTGCAGATGAAGAACCAGCTTGG + Intergenic
1017785904 6:157757070-157757092 CTAGAGAGGCAGCACCATCTTGG - Intronic
1019276710 7:179677-179699 GAGGAGAAGCAAACCCATCAAGG + Intergenic
1020907522 7:14082494-14082516 GTTGAGAAACTGCACCATCTGGG - Intergenic
1022227902 7:28382343-28382365 ATTTAGAAGCAAAACCATCTGGG + Intronic
1025250584 7:57348889-57348911 CTGGAGAAGCAGAACCACCCTGG + Intergenic
1026140921 7:67705905-67705927 GGAGAGAAGCAGAACCTGCTTGG - Intergenic
1031439170 7:121772107-121772129 TTGGAGAAGCAGTGCCATATTGG - Intergenic
1032139982 7:129319593-129319615 GTGGGGAAGCAGACGCATGTTGG + Intronic
1032192678 7:129773589-129773611 GGGGAGAAGCAGCCCCATCAGGG + Intergenic
1034588900 7:152121757-152121779 TGGGTGGAGCAGAACCATCTTGG + Exonic
1036216625 8:6884814-6884836 GTGGAGAGGCAGGGCCAGCTGGG + Intergenic
1038070429 8:24007134-24007156 CTGCAGAAGCAGGACCACCTGGG + Intergenic
1038670141 8:29576662-29576684 GTGGGGATGCAGAACCATAGAGG - Intergenic
1038732276 8:30138282-30138304 GTGGAGAAGGTGAACCCACTGGG + Exonic
1041184752 8:55287462-55287484 TAGGAGAAGCTGAAACATCTTGG - Intronic
1042502317 8:69523073-69523095 GAGGAGAAGCATGATCATCTGGG + Intronic
1043364020 8:79510524-79510546 GTGCTGAAGAAGAGCCATCTTGG + Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1051859801 9:21611582-21611604 GTAGAGATGAAGAACAATCTGGG + Intergenic
1052125346 9:24767474-24767496 GTGGAAAAGCAGAGACTTCTTGG + Intergenic
1052471925 9:28909077-28909099 TTTGAGAAGCAGAATTATCTGGG - Intergenic
1052665594 9:31491286-31491308 CTAGAATAGCAGAACCATCTGGG + Intergenic
1055431674 9:76250249-76250271 GGGGAGCAGCAGTGCCATCTCGG - Intronic
1055739664 9:79373073-79373095 GCAGAGAAACAGAACCATATTGG + Intergenic
1056461075 9:86810394-86810416 GTGGAGAAGAAGAACAATTCTGG + Intergenic
1058422388 9:104844279-104844301 GTAGAGAAGCTGGACCAACTGGG - Intronic
1059243432 9:112828380-112828402 GTGTAGTAGCCGCACCATCTAGG + Intronic
1059814362 9:117894899-117894921 TTGTTGAAGCAGAACCATCATGG + Intergenic
1060057280 9:120425731-120425753 GTGGAAAGGAAGAAACATCTGGG - Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186282856 X:8012975-8012997 GTGGAGAGGAGGAATCATCTAGG - Intergenic
1186917426 X:14238495-14238517 GTGAAGAGCCAGAAACATCTAGG - Intergenic
1187265052 X:17724378-17724400 GAGGAGGAGGAAAACCATCTCGG + Exonic
1188878799 X:35466715-35466737 CTGGAGTAGCAGCACGATCTCGG - Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1194045039 X:88992020-88992042 GTGGAGAAGGTGAACCCGCTGGG - Intergenic
1194188635 X:90807661-90807683 TTGGAGAGGCCAAACCATCTGGG - Intergenic
1194647658 X:96477707-96477729 GTGGAGAAGCATAACCCTCATGG - Intergenic
1194972339 X:100357970-100357992 CTGAAGAAGTAGAACCACCTTGG - Intronic
1195377684 X:104243843-104243865 GTGAAGAAATAGAACCATCCTGG + Intergenic
1196679239 X:118453963-118453985 CTGGAGAAGCAGCAGCAGCTGGG + Intergenic
1196968152 X:121080455-121080477 GTGGAAAAGCAGTACAATGTGGG - Intergenic
1197254745 X:124250742-124250764 GTGGAGAAGCATAGCCATTTAGG + Intronic
1197512516 X:127388063-127388085 GTAGAGAAGCAGAGCTATATAGG + Intergenic
1200535219 Y:4389556-4389578 TTGGAGAGGCCAAACCATCTGGG - Intergenic
1200921284 Y:8615612-8615634 TGGTAGAAGCAGAACCGTCTGGG - Intergenic