ID: 1061572318

View in Genome Browser
Species Human (GRCh38)
Location 9:131485413-131485435
Sequence ACGGCTCCAGCACATGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061572318_1061572320 -9 Left 1061572318 9:131485413-131485435 CCTGGGTCATGTGCTGGAGCCGT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1061572320 9:131485427-131485449 TGGAGCCGTGTCGCCTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061572318 Original CRISPR ACGGCTCCAGCACATGACCC AGG (reversed) Intronic
900330025 1:2129490-2129512 TGGGCTCCAGGACAGGACCCTGG + Intronic
900945315 1:5828017-5828039 ACCGCTCCAGCACCTGGGCCTGG - Intergenic
901434811 1:9240882-9240904 ACGGCTCCAACACATCTCCTGGG - Intronic
904970372 1:34414742-34414764 AAGGCTCCATCCCATGGCCCTGG + Intergenic
908264931 1:62368952-62368974 ATGGGTCCAGCACATGACAATGG - Intergenic
912740031 1:112186125-112186147 ACAGCTCCAGGAGCTGACCCGGG + Intergenic
917498981 1:175568647-175568669 AGGGCTCCAGCAATTGATCCAGG - Intronic
917674759 1:177308332-177308354 ACTGCTCTATCACATCACCCAGG + Intergenic
917860379 1:179138181-179138203 ACAGCTCCAGAGAATGACCCAGG + Intronic
919781065 1:201221544-201221566 ACAGCTCCACCACATACCCCTGG - Exonic
919922327 1:202174067-202174089 CCAGCCCCAGCAGATGACCCTGG - Intergenic
920053125 1:203175339-203175361 AGAGCTCCAGCACATAGCCCTGG + Exonic
920339734 1:205268293-205268315 AAAGCTCCAGCACATGGACCAGG - Intronic
921346884 1:214195530-214195552 ACAGCTCAAGGACATAACCCTGG + Intergenic
922567157 1:226608216-226608238 CCTGCTCCAGCACAGGAACCAGG + Exonic
1065464507 10:26004622-26004644 AGGGCTCCATGAGATGACCCTGG + Intronic
1074473945 10:113752759-113752781 ATGGTTGCAGCACATGACTCTGG + Intronic
1075963051 10:126585768-126585790 AAGGCTCAAGCACATTAACCCGG - Intronic
1076259574 10:129054833-129054855 AAGGCCCCAGCACAGGACCATGG + Intergenic
1077183543 11:1226823-1226845 ACGCCTCCAGCACCAGCCCCTGG - Exonic
1077412243 11:2409049-2409071 ACCCCTCCAGCTCAGGACCCAGG - Intronic
1080283638 11:30585525-30585547 GCGGCTCGAACACATCACCCCGG + Intronic
1083186009 11:61018307-61018329 ACAGCTCCAGCACCTCATCCGGG + Exonic
1084097781 11:66923413-66923435 ACAGCTCCACCACATGACACAGG + Intronic
1086497865 11:87422495-87422517 ATGCCTCCAGCACCTCACCCAGG - Intergenic
1089953576 11:122550898-122550920 AAGGCTACAGGACATGATCCTGG - Intergenic
1091394064 12:142884-142906 ACGGGGCCAGCACCTCACCCTGG - Intronic
1092002754 12:5045086-5045108 ACCGCTCCTGCCCAGGACCCTGG + Exonic
1100518296 12:95349562-95349584 AGGGCCCAGGCACATGACCCAGG - Intergenic
1101479525 12:105084010-105084032 ATGGCTCCAGCTCTTGACCAGGG + Intronic
1102712011 12:114936417-114936439 ACGGAAACAGCACAAGACCCAGG + Intergenic
1103465393 12:121138481-121138503 CGGGAGCCAGCACATGACCCAGG - Intronic
1104016306 12:124964708-124964730 ACGTCTCCAGCACACCAGCCTGG - Intronic
1106174719 13:27320490-27320512 GAGGTTCCAGCAGATGACCCTGG - Intergenic
1107757732 13:43643316-43643338 ACAGATCCAGCACAGCACCCTGG + Intronic
1114191889 14:20445782-20445804 GCAGCTCCAGAACATGACCAAGG + Intergenic
1117030454 14:51663815-51663837 ACGGCACCAGCATCTGGCCCAGG + Intronic
1118842258 14:69522158-69522180 TCTGGTGCAGCACATGACCCAGG + Intronic
1118849198 14:69571819-69571841 ACGGCTGCAGCACGCGACGCAGG - Exonic
1120533894 14:85668376-85668398 ACAGCTCCAACACATGACTTGGG + Intergenic
1121642575 14:95495676-95495698 ATGGCTCCAGCACCTGTGCCAGG + Intergenic
1121676953 14:95761189-95761211 ACTGCTACAGCATATTACCCTGG + Intergenic
1123065016 14:105614246-105614268 CCGGTTCCAGTGCATGACCCAGG - Intergenic
1123069210 14:105633681-105633703 CCGGTTCCAGTGCATGACCCAGG - Intergenic
1127381430 15:58433964-58433986 AGGGCTCCACCACAGGACACCGG - Intronic
1128750018 15:70142078-70142100 AGGACACCAGCCCATGACCCAGG + Intergenic
1129256356 15:74336217-74336239 AAGGCTGCAGCAGAAGACCCAGG - Intronic
1129514909 15:76151463-76151485 AGGGCTCCAGAACAGGGCCCTGG - Intronic
1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG + Intergenic
1131312297 15:91302006-91302028 ACATCTGCAGCAGATGACCCTGG - Intergenic
1132373689 15:101314586-101314608 AGGGCTCAAGCACAAGGCCCTGG + Intronic
1132645738 16:998523-998545 AGGGTTCCAGGCCATGACCCTGG + Intergenic
1139579303 16:67862838-67862860 ACAGCACCAGCAAATGTCCCGGG - Intronic
1142121111 16:88387151-88387173 ACGGCGTCCGCACCTGACCCAGG - Intergenic
1142200289 16:88757863-88757885 TCAGCTCCAGCAGATGCCCCAGG + Intronic
1143565346 17:7717390-7717412 ACGGGTCCAGCAGATGGCGCCGG - Exonic
1146466585 17:33091111-33091133 AGGGCTCCATCACCTAACCCAGG + Intronic
1152068459 17:78123963-78123985 ATGCCTCCACCTCATGACCCAGG - Intronic
1157102628 18:44744256-44744278 GCAGCTCCAGCAGATGAGCCTGG - Intronic
1158393031 18:57059013-57059035 ACAGTTCCACCAGATGACCCAGG - Intergenic
1159580981 18:70234606-70234628 GCGGCTCCAGCCCATGAGACAGG + Intergenic
1160336337 18:78043487-78043509 ATGGCACCAGCACCTGAGCCAGG + Intergenic
1162295353 19:9809740-9809762 ATGCCTCCATCACGTGACCCTGG + Intergenic
1162570117 19:11466680-11466702 CCTGCCCCAGAACATGACCCAGG - Exonic
1167513307 19:49908460-49908482 ACAGCTCAAGCGCATGGCCCAGG - Exonic
926160572 2:10486592-10486614 ACGGCTTGAGGACAGGACCCAGG + Intergenic
926482698 2:13419515-13419537 ACGTCTCCATCACATGACCTAGG - Intergenic
932605478 2:73162955-73162977 ACGGCTCCTGCCCATGGCCAAGG - Intergenic
938689816 2:133777203-133777225 ACAGCTCCAGCCCTTGAGCCTGG + Intergenic
942459275 2:176158400-176158422 ACTGCCCCAGCCCACGACCCTGG - Intronic
942653648 2:178194068-178194090 ACGGCTCCAGCGCTCGGCCCAGG - Intergenic
942725105 2:178997548-178997570 ACAGCTCCAGCACCTGTCACTGG + Intronic
948783162 2:240337334-240337356 ACCACCCCAGCACATGACCAAGG + Intergenic
1170603394 20:17858958-17858980 ACAGCTCCATCACCCGACCCTGG - Intergenic
1172319252 20:33983435-33983457 AGGACCCCAGCAGATGACCCCGG + Intergenic
1173120492 20:40284814-40284836 AGGGCCCCAGCACACGCCCCAGG + Intergenic
1173932513 20:46832649-46832671 CCAGCCCCAGCAGATGACCCAGG + Intergenic
1178410277 21:32358161-32358183 ACGGCTCCAGCACAGGAACAGGG - Intronic
1178600287 21:33988634-33988656 AGGGCTCAAGCACATGACCTAGG - Intergenic
1180080630 21:45486118-45486140 ATGGCTCCAGCACATGCCTCCGG + Intronic
1180211487 21:46297592-46297614 CCGGCTGCAGCCCCTGACCCGGG + Exonic
1181174732 22:21029068-21029090 CAGGCACCAGCACAGGACCCTGG - Exonic
1182298820 22:29326918-29326940 ACAGCTCGAGCCCTTGACCCTGG + Intergenic
1183025079 22:35058757-35058779 ACAGCTCCAGCTGAAGACCCAGG - Intergenic
1184235543 22:43181101-43181123 GCAGCGCCAGCACCTGACCCAGG - Intronic
1184245039 22:43231535-43231557 AGGGCTTCAGCACATGTCCCAGG - Intronic
1184946089 22:47805180-47805202 ATGGCTCCAGCATCTGCCCCTGG + Intergenic
1185317811 22:50186329-50186351 CCGGCTCCAAAACCTGACCCGGG - Intronic
952560886 3:34592349-34592371 AGAGCTACAGCACATAACCCAGG - Intergenic
961459026 3:127038634-127038656 AGGGCTCCAGCCCATCAGCCTGG + Intergenic
963521863 3:146365838-146365860 AAGGCTACAGGACATGATCCTGG - Intergenic
966138743 3:176730878-176730900 ACGGCTCAAGCACAGGATCTAGG + Intergenic
968690979 4:1990023-1990045 ACGGCTCCAGCAGAACACCCAGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969662620 4:8539035-8539057 ATGGCTCCAGGACATGGCCATGG + Intergenic
970028985 4:11655671-11655693 AAGGCTACAGGACATGATCCTGG + Intergenic
970052936 4:11936803-11936825 ATGGCTCCAGCATATGCTCCTGG + Intergenic
970243473 4:14033654-14033676 ACGGCTCATGCACATAATCCTGG + Intergenic
970444753 4:16114455-16114477 ACAGCTCCAGAAGATGAACCTGG - Intergenic
971254703 4:25003739-25003761 ACTGTTCCACCTCATGACCCGGG + Exonic
982211056 4:153036814-153036836 AGGGCTCCACCACATTGCCCAGG + Intergenic
984590038 4:181606884-181606906 ATGGCTCCCGCAAATGGCCCTGG - Intergenic
990925008 5:61010967-61010989 ACAGCGCCATCTCATGACCCAGG - Intronic
999269072 5:150285953-150285975 ACGGATGCAGCAGATGGCCCAGG - Intronic
1002640293 5:180627580-180627602 ATGGCACCAGCACATGACGATGG - Intronic
1003247546 6:4397098-4397120 ATGGCTGCATCGCATGACCCTGG - Intergenic
1006449612 6:34098584-34098606 ACGGGGCCAGCACAAGCCCCAGG + Intronic
1013099541 6:106975034-106975056 GCGCCTCCGGCACAGGACCCGGG + Intronic
1018056619 6:160057439-160057461 ACGGCCCCAGCACAGGGTCCTGG + Intronic
1018059448 6:160079080-160079102 AGGGCTCCATCACAGGAGCCAGG - Intronic
1018659639 6:166074033-166074055 ACGGCTCCTCCACCTGTCCCTGG - Intergenic
1018953916 6:168395384-168395406 AGGGCTCCAGCATGTGACGCTGG - Intergenic
1019179769 6:170178893-170178915 CCCCATCCAGCACATGACCCAGG + Intergenic
1019624593 7:2009554-2009576 ACAGCCCCAGCACCTGCCCCTGG + Intronic
1019750341 7:2725235-2725257 ATGGCTCCAGCCCCTGAACCCGG - Intronic
1021637590 7:22707188-22707210 AAGGCTACAGGACATGATCCCGG - Intergenic
1023120785 7:36906146-36906168 ACCACTCCAGCAAATCACCCTGG + Intronic
1023984684 7:45087949-45087971 ACAGAGCCAGCACAAGACCCTGG + Intronic
1024216653 7:47254364-47254386 GCGGCTCCAGCAAGGGACCCAGG - Intergenic
1027259657 7:76455772-76455794 ATGGCGCCAGCTCAGGACCCAGG + Intergenic
1027282817 7:76621122-76621144 ATGGCGCCAGCTCAGGACCCAGG - Intronic
1027311027 7:76953860-76953882 ATGGCGCCAGCTCAGGACCCAGG + Intergenic
1033153899 7:138940093-138940115 ATGGGTGCAGCACATGAACCTGG - Intronic
1034374440 7:150630064-150630086 ACAGCTCCAGCACAGGATCCTGG + Exonic
1038229276 8:25685481-25685503 ACGGCTCCAGCCAATCAGCCAGG - Intergenic
1046945864 8:119973657-119973679 ACAGCTGCAGCAGCTGACCCTGG + Intronic
1051586588 9:18733141-18733163 ACGGTTACAGCACAGTACCCAGG - Intronic
1053410238 9:37911595-37911617 CCAGCTCCAGCCCCTGACCCTGG + Intronic
1057805958 9:98220192-98220214 ACTTCTTCAGCACATGACCCTGG + Intronic
1061163910 9:128911570-128911592 ACAGCCCCAGCACAGCACCCGGG - Intronic
1061572318 9:131485413-131485435 ACGGCTCCAGCACATGACCCAGG - Intronic
1188431269 X:30107125-30107147 AAGGCTACAGGACATGATCCCGG - Intergenic
1196945356 X:120819178-120819200 ATGGCTCCAGCACCAGACCTGGG + Intergenic