ID: 1061573605

View in Genome Browser
Species Human (GRCh38)
Location 9:131492642-131492664
Sequence AAGTCTGAGGAAAGAGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 271}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061573605_1061573607 -3 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573607 9:131492662-131492684 CTTGCCCTATGACCCCTGCCAGG No data
1061573605_1061573608 -2 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573608 9:131492663-131492685 TTGCCCTATGACCCCTGCCAGGG No data
1061573605_1061573617 15 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573617 9:131492680-131492702 CCAGGGGACTTTTTATTGCTGGG No data
1061573605_1061573619 23 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573619 9:131492688-131492710 CTTTTTATTGCTGGGCTTATGGG No data
1061573605_1061573618 22 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573618 9:131492687-131492709 ACTTTTTATTGCTGGGCTTATGG No data
1061573605_1061573620 24 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573620 9:131492689-131492711 TTTTTATTGCTGGGCTTATGGGG No data
1061573605_1061573615 14 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573615 9:131492679-131492701 GCCAGGGGACTTTTTATTGCTGG No data
1061573605_1061573609 -1 Left 1061573605 9:131492642-131492664 CCAGCGTCTCTTTCCTCAGACTT 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1061573609 9:131492664-131492686 TGCCCTATGACCCCTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061573605 Original CRISPR AAGTCTGAGGAAAGAGACGC TGG (reversed) Intronic
903393567 1:22982227-22982249 AAGTCTGAGGAAAGAGCCCAAGG + Intergenic
904111386 1:28129049-28129071 AAGGCTGAGGAAGCAGACTCAGG + Intergenic
904362384 1:29984837-29984859 AAGCTTGAGGATAGAGAGGCTGG - Intergenic
904882413 1:33710928-33710950 AAGTCTTAGGAAACTGAAGCTGG - Intronic
905348392 1:37327504-37327526 GAGGCTGAGGACAGAGAAGCTGG + Intergenic
906047000 1:42838839-42838861 AGCTCTGAGGAAAAAGAGGCAGG + Intronic
908629759 1:66090019-66090041 AACTCTTAGGAAAGAGAAGAAGG + Intronic
910382373 1:86642200-86642222 AAGTTTGAGGAAAAAGGGGCAGG - Intergenic
910455961 1:87397484-87397506 AAGACTGGGGAAAGAGAGTCTGG + Intergenic
914762844 1:150612906-150612928 AAACCTGAGTAAAGAGATGCTGG + Intronic
915199331 1:154215139-154215161 AAGGCTGAGGCAAGAGAGGCTGG - Intronic
916015859 1:160749464-160749486 AAGCCTGAGGACAGAGACTAGGG + Intronic
916352947 1:163872776-163872798 GAGTTTGGGGAAAGAGACGAAGG + Intergenic
916837956 1:168568484-168568506 AAGTCTTAAGCAAGAGACGTTGG - Intergenic
918475240 1:184917570-184917592 AAGTCTGAGTAAAGGGAGGGTGG - Intronic
918940537 1:190990503-190990525 AAGTTTCCGGAAAGAGACACAGG - Intergenic
919422329 1:197385484-197385506 AAGTATGAGGAGAAAGACTCTGG - Intronic
920279548 1:204832314-204832336 GAGTCAGAGGAAAGAGGCTCTGG + Intronic
920628005 1:207622679-207622701 AAGTCTTAGGCAAGAGACATGGG + Intronic
923490796 1:234482358-234482380 AAGTCTCAGGAGAGAGACCTAGG - Intergenic
924198783 1:241639506-241639528 CACTTTGAGGAAAGAGACGAGGG - Intronic
1067343129 10:45419918-45419940 ATGGCGGAGGAAAGAGAGGCCGG + Intronic
1067394492 10:45901450-45901472 TATTCTGAGGAAAGAAAAGCAGG + Intergenic
1067862815 10:49870581-49870603 TATTCTGAGGAAAGAAAAGCAGG + Intronic
1069898201 10:71691904-71691926 AAGACTGAGGAAGGGGACCCAGG + Intronic
1071573656 10:86711303-86711325 AAGGAGGAGGAAGGAGACGCAGG - Intronic
1075537948 10:123286871-123286893 AAGGCAGAGGAAAGAGACCTGGG - Intergenic
1078682961 11:13497459-13497481 AAGTCTGAGGAAAAAAAGACGGG + Intergenic
1078841401 11:15078740-15078762 ACCTCTGAGGAAACAGAGGCAGG + Intronic
1079214163 11:18491559-18491581 TAGGCTGAGGAAAGACACGTGGG - Intronic
1080746803 11:35115623-35115645 AAGTCTGAGGTCTGAGATGCGGG - Intergenic
1081983120 11:47282447-47282469 CAGGCCGAGGAAAGAGGCGCAGG - Exonic
1082173147 11:49030556-49030578 AAGTTTCAGGAGAGAGACGGAGG + Intronic
1082902109 11:58266359-58266381 GATTTTGAGCAAAGAGACGCTGG + Intergenic
1083717206 11:64584247-64584269 AAGTTTGAAGACAGAGAGGCGGG - Intergenic
1084499399 11:69525816-69525838 GAGTCTGAGGACAGAGAATCTGG - Intergenic
1084502450 11:69542889-69542911 AGTTCTGAGCAAAGATACGCAGG - Intergenic
1085084552 11:73658074-73658096 AAGTCTGATGGGAGAGACACAGG + Intronic
1085660547 11:78361736-78361758 AAGACTGTGGAAAAAGAGGCAGG + Intronic
1086311019 11:85536611-85536633 AAGTGTGAAGAGAGAGGCGCAGG + Intronic
1086692620 11:89805495-89805517 AAGTTTCAGGAGAGAGACGGAGG - Intronic
1086713180 11:90034165-90034187 AAGTTTCAGGAGAGAGACGGAGG + Intronic
1088740701 11:112764758-112764780 TGGTCTGAGGATAGAGACTCTGG + Intergenic
1088976850 11:114823366-114823388 AAGACTGAGGAAGGTGAAGCTGG - Intergenic
1089017141 11:115175055-115175077 AAGGCTGAGGAAAGAGGCCAAGG + Exonic
1089105437 11:115999363-115999385 AAGACTGAGGAAAGAGATGATGG + Intergenic
1091306187 11:134537555-134537577 AAGAATGAGCAAAGGGACGCTGG - Intergenic
1092105216 12:5916984-5917006 AAGTCTGATGACAGGGACGCTGG + Intronic
1092540829 12:9418999-9419021 AAGTCTGAGGAAGGTGAGGGGGG - Intergenic
1092991768 12:13909823-13909845 AAGTATCAGGAAAGAGAGGAGGG + Intronic
1093801163 12:23375243-23375265 AAAGCTGAGGAAAGAGAGCCAGG + Intergenic
1095135861 12:38602229-38602251 AAGTCTGAGTAAAAAGATGAAGG + Intergenic
1096244175 12:49975179-49975201 AAGTGAGAGGAAAGAGGCGGGGG + Intronic
1096758963 12:53824134-53824156 AAGTGTGAGTCAAGAGACACGGG - Intergenic
1100512972 12:95295464-95295486 AAGTCTGAGATAAAAGAAGCAGG - Intronic
1101783813 12:107864324-107864346 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
1102189237 12:110973690-110973712 AATTCTCAAGAAAGAGAAGCTGG - Intergenic
1102364444 12:112319739-112319761 AAATCTAAGGAAAAAGACGATGG + Exonic
1102935900 12:116896814-116896836 AGGTCTGAAGAAACAGACCCTGG - Intergenic
1103113520 12:118304349-118304371 AGGTCTCAGGGAAGAGACACAGG + Intronic
1104337237 12:127910812-127910834 AAGTGTGAGGTAAGAGAGGAAGG - Intergenic
1105201262 13:18181550-18181572 AAGTCTCAGGAAAAAGAACCAGG - Intergenic
1105237198 13:18568085-18568107 AAGTGTGAAGAGAGAGGCGCGGG - Intergenic
1106099430 13:26681714-26681736 AAGTCTGAGAAATGAGGCACAGG - Intronic
1106183946 13:27391970-27391992 AACTCTGAGGCAGGAGACACGGG + Intergenic
1108492352 13:50994174-50994196 AAGGAGGAGGAAAGAGACCCAGG - Intergenic
1108532522 13:51341048-51341070 AATTCAGAGGGAAGAGATGCAGG - Exonic
1109845453 13:67983746-67983768 TAGTCTGAGAACAGAGAAGCTGG + Intergenic
1110301977 13:73939176-73939198 AAGTCTGAGGAATCTGCCGCGGG - Intronic
1110969633 13:81745270-81745292 AAGTGTGAGGCAAGAGGTGCAGG - Intergenic
1111116010 13:83779229-83779251 AAAACTGAGGAAAGAGAGCCAGG + Intergenic
1112430268 13:99344988-99345010 AAATCTGAGGAGAGAGCCACTGG + Intronic
1114996190 14:28355311-28355333 AAGCCTGAGGCAAAAGAAGCTGG - Intergenic
1116015900 14:39406758-39406780 AAGTCTGAAGAGAGAACCGCTGG + Intronic
1117621132 14:57588081-57588103 GAGGCTGAGGAAAGAGGCGAAGG + Intronic
1118074610 14:62284354-62284376 AAGTGAGTGGAAAGAGAAGCGGG - Intergenic
1118916898 14:70115274-70115296 AATTCTGAGGGAAGAGAAGTGGG - Intronic
1119517934 14:75263016-75263038 AGGTCTGAGAAATGAGATGCTGG + Intronic
1119708942 14:76807385-76807407 AAGTCTGTGGAAAGAAAAGCTGG + Intronic
1120578648 14:86217740-86217762 AAGAAGGAGGAAAGAGACCCCGG - Intergenic
1122340471 14:101024962-101024984 TAGTGAGAGGAAAGAGACACCGG + Intergenic
1122660683 14:103293009-103293031 CAGTCTGAGGACAGAGATGAGGG + Intergenic
1122926403 14:104904968-104904990 AAGTCTCAGGAGATAGACGTTGG - Intergenic
1124656355 15:31512106-31512128 AAGACTGAGGAAAAAGCTGCGGG - Intronic
1126657098 15:50990470-50990492 AAGTCTGAGGCATGAGAACCTGG - Intronic
1129412928 15:75359772-75359794 ATGTCTGAGGAAAGACTGGCTGG + Exonic
1129460498 15:75698001-75698023 AGGCCTGAGGAAGGAGACGGAGG + Intronic
1129724365 15:77894035-77894057 AGGCCTGAGGAAGGAGACGGAGG - Intergenic
1130874425 15:88000135-88000157 AAGTCTGAGGATTTAGACACAGG + Intronic
1131075830 15:89494299-89494321 AAGTCTGGGGACAGAGACCCAGG + Intronic
1132668611 16:1093756-1093778 GAGGCTGAGGAAGTAGACGCCGG + Exonic
1133378666 16:5311553-5311575 AAGTCAGAAGAAAGAGATGTTGG - Intergenic
1134219342 16:12341388-12341410 AAGTCTGAGGAAAGGCACAGAGG - Intronic
1134829186 16:17309684-17309706 AAGGCAGAGGAATGAGATGCAGG - Intronic
1134880794 16:17743869-17743891 AAGACTGAGGACAGAGAGACAGG + Intergenic
1136066400 16:27761753-27761775 AAGGCTCAGGAAAGAGAGGTGGG + Intronic
1138067196 16:53954658-53954680 AAGGCAGAGTAAAGAGACGACGG + Intronic
1138113121 16:54340195-54340217 AAGGCTGAGGAAGGAGGAGCTGG - Intergenic
1138159323 16:54738433-54738455 AAGTATGAGAAAAGAGACAGAGG - Intergenic
1139292344 16:65870273-65870295 CATTCTGTGGAAAGAGACACTGG - Intergenic
1140722926 16:77787728-77787750 CAGTTTAAGGAAAGAGATGCAGG - Intergenic
1141906221 16:87028722-87028744 ATGTCTGTGGACAGAGATGCTGG - Intergenic
1143653441 17:8278743-8278765 GAGGCTGAAGAAAGAGACGGTGG - Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145723265 17:27091377-27091399 AAGTCTGGGGAACGGGAAGCGGG + Intergenic
1147445740 17:40474361-40474383 AAGACTGGGGAGAGAGACACTGG + Intergenic
1147452313 17:40513241-40513263 AAGTCTGAGGACTGAGTCGGGGG - Intergenic
1147876931 17:43628414-43628436 AAGTCTGAGCAGAGAGTCTCTGG - Intergenic
1150250740 17:63703128-63703150 AGGTCTGAGGGAAGGGAGGCAGG + Exonic
1150290137 17:63976418-63976440 AGGTCTGAGGAAAGAGGAGAAGG - Intergenic
1151151658 17:72093264-72093286 AAGACTGAGCAAAGAGATGCTGG + Intergenic
1151210290 17:72539256-72539278 AAGTCTGGGGACTGAGAGGCGGG - Intergenic
1151371432 17:73648610-73648632 CACTCTGAGGAATGAGATGCTGG - Intergenic
1153108975 18:1560879-1560901 AAAGCTGAGGAAAGAGAGCCAGG - Intergenic
1153919681 18:9777236-9777258 AAGGCTGAGGCAAGAGAAGGTGG + Intronic
1156517828 18:37696118-37696140 AAATCTGAGAAAAGAGACTATGG - Intergenic
1157464650 18:47932430-47932452 ATGTGTGAGGACAGAGACGGTGG - Intergenic
1157753202 18:50195895-50195917 AAGTCTGTGGAGGGAGACGAGGG + Intergenic
1161751474 19:6100430-6100452 AGGTCTGTGCAAAGAGCCGCAGG + Intronic
1161774106 19:6248655-6248677 AAGACTGAGGAAAGAGACACAGG + Intronic
1163136838 19:15317649-15317671 AGGTCAGGGGAAAGAGACACAGG + Intronic
1166306443 19:41939030-41939052 GGGTCTGAGGGAGGAGACGCGGG - Intergenic
1166306562 19:41939367-41939389 GAGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166521939 19:43486546-43486568 AGGTCTGAGGGAGGAGAGGCTGG + Intronic
1166531608 19:43546460-43546482 GAGTCTGAGGGAAGAGAGCCTGG - Intronic
1166533458 19:43556352-43556374 AAGCCTGTGGAAAGAGTCCCTGG + Intronic
1166676877 19:44746320-44746342 GAGTCTGAGGAAGGAGGCGAGGG - Intergenic
1166688471 19:44809511-44809533 GGGTCTGAGGAAAGAGGGGCTGG - Intronic
1166945405 19:46393262-46393284 AAGTCAGAACAAAGAGACTCAGG + Intergenic
1167261981 19:48463881-48463903 AAGAGAGAGGAAAGAGACTCAGG - Intronic
1167295126 19:48645344-48645366 GAGTCTGAAGAAGGAGGCGCCGG + Intronic
1167426978 19:49434437-49434459 AGGTCTGAGGGAAGAGGGGCTGG - Intronic
1167853817 19:52221897-52221919 AAGCCTGAGGACAGAGAAACTGG + Intronic
1168147847 19:54429747-54429769 GAGTCTGAGGGAAGAGGGGCTGG + Intronic
1168155862 19:54472769-54472791 GAGTCTGAGGGAAGAGGGGCTGG - Intronic
1168263378 19:55208507-55208529 GAGTCTGAGGGAAGAGGGGCTGG + Intronic
1168263483 19:55208800-55208822 GAGTCTGAGGGAAGAGGGGCTGG + Intronic
1168277296 19:55284942-55284964 GAGTCTGAGGGAGGAGAGGCTGG + Intronic
1168327866 19:55547116-55547138 GGGTCTGAGGAAGGAGAGGCTGG - Intergenic
925323916 2:3000895-3000917 AAGTTTGAGGGCAGAGATGCTGG - Intergenic
925427224 2:3760092-3760114 AAGTCTGATGACAGAGATCCAGG - Intronic
925931262 2:8709815-8709837 CAGAGAGAGGAAAGAGACGCAGG + Intergenic
929341605 2:40825595-40825617 TAATCTGAAGAAAGAGACACTGG - Intergenic
929539482 2:42809317-42809339 AAGCCTGAAGGAAGAGACGGGGG + Intergenic
930243504 2:48959795-48959817 AAATCTGAGGAAATAGACATGGG + Intergenic
930401822 2:50899671-50899693 AAGTCTGTAGAAAGACAAGCAGG + Intronic
930513912 2:52381180-52381202 AAAACTGAGGAAAGAGAGCCAGG - Intergenic
930681390 2:54260299-54260321 GAGTCTGAGGACAGAGAAGAAGG + Intronic
932697585 2:73969614-73969636 AAGTCTGAGGAGAGAGTCCAGGG - Intergenic
932796914 2:74703844-74703866 AAGCCTTAAGAAAGAGATGCAGG - Intergenic
933047115 2:77553177-77553199 AAGTCTGAGGAAAGAAACAGTGG + Intronic
933651796 2:84855752-84855774 AAGTCTCAGGAAAGAGAAAAAGG - Intronic
935180900 2:100690553-100690575 CAGTCTGATGAAAGAGAAGGAGG - Intergenic
937667370 2:124502266-124502288 GAGACTGAGGAAAGAGAGCCAGG + Intronic
937909268 2:127067631-127067653 AAGTCCGAGGAAAATGACGCAGG + Intronic
938512579 2:131966428-131966450 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
940453794 2:153872106-153872128 AAGTGTGAAGAGAGAGGCGCGGG + Exonic
940750450 2:157621636-157621658 AAGTCTGTGGAAAGAGGTGGCGG - Intronic
943248588 2:185487267-185487289 AAGTCAGAGGAAACAGAGACTGG + Intergenic
944655853 2:201876338-201876360 AAGGCTGAGGAAAGAGTCCCGGG - Intronic
945018826 2:205550287-205550309 AAGTCTGAGGAAGGAGGCAGTGG - Intronic
945272893 2:207959591-207959613 AAATATGAGGAAAGAGAAGCAGG - Intronic
946281808 2:218671500-218671522 AAGGCTGAGGAAAGCGTCGGCGG + Intronic
949006333 2:241650816-241650838 AACTCTTAGGAAAGAGAAGGAGG - Intronic
1170071507 20:12374152-12374174 AAGACTGAGAAGAGAGAAGCGGG - Intergenic
1174100248 20:48121712-48121734 TAGTCTGAGGGTAGAGAAGCTGG - Intergenic
1174407669 20:50312701-50312723 AAGTAGGAGGACAGAGAAGCCGG - Intergenic
1176546510 21:8204529-8204551 AAGAATGAGGAAAGAAACGAAGG - Intergenic
1176554404 21:8248720-8248742 AAGAATGAGGAAAGAAACGAAGG - Intergenic
1176565461 21:8387576-8387598 AAGAATGAGGAAAGAAACGAAGG - Intergenic
1176573326 21:8431744-8431766 AAGAATGAGGAAAGAAACGAAGG - Intergenic
1176781183 21:13196367-13196389 AAGTGTGAAGAGAGAGGCGCGGG - Intergenic
1177972089 21:27802770-27802792 AAATTTGAGGAAAGAGTCCCAGG + Intergenic
1180756509 22:18165661-18165683 AAGTCTCAGGAAAGATCAGCTGG - Intronic
1181075260 22:20371772-20371794 AAGTCTCAGGAAAGATCAGCTGG + Intronic
1184586883 22:45453978-45454000 ATGTCTGAGGAAAGAGTGACGGG + Intergenic
1203251373 22_KI270733v1_random:120791-120813 AAGAATGAGGAAAGAAACGAAGG - Intergenic
1203259419 22_KI270733v1_random:165865-165887 AAGAATGAGGAAAGAAACGAAGG - Intergenic
949413673 3:3794156-3794178 AAGGAGGAAGAAAGAGACGCGGG + Intronic
949627373 3:5882060-5882082 AACTCAGAGGAAAGAGAAGGAGG - Intergenic
951267658 3:20588484-20588506 AATTCTGAGGAAACAGAGGTAGG + Intergenic
952189691 3:31009568-31009590 ACTTCTCAGGAAAGAGATGCAGG + Intergenic
954701100 3:52451303-52451325 AACTCTGTGGAAAGAGGGGCAGG + Exonic
955717715 3:61847954-61847976 AAGTCTGAGGAAGAAGACAAGGG - Intronic
956918051 3:73894732-73894754 AAGTCTGAGAAATTAGATGCAGG - Intergenic
959290075 3:104462641-104462663 AAGTCTGAAGAAAAGGAGGCAGG - Intergenic
959900074 3:111651097-111651119 ATGTCTGAGGAGTGAGACACAGG + Exonic
961469444 3:127101992-127102014 AAGTCTGGGGCAAGAGCAGCTGG - Intergenic
962982827 3:140506385-140506407 GAGTGTGACGAAAGAGAGGCAGG - Intronic
963648823 3:147950683-147950705 AAGGCTCAGGAAACAGACTCTGG + Intergenic
964940787 3:162156557-162156579 AAGTGAGAGCAAAGAGAGGCTGG + Intergenic
965975527 3:174615557-174615579 AAGCCTGAGGAAAAAGTTGCAGG + Intronic
966780306 3:183578664-183578686 AAGTTTGAGGAAGGAGATGATGG + Intergenic
967363047 3:188653882-188653904 AAGCCTGAGGACAGATACGATGG - Intronic
968148377 3:196318393-196318415 CAGTCGGAGGAAATAGACGCGGG + Intronic
969954665 4:10876441-10876463 ATGGATGAGGAAAGAGAGGCCGG - Intergenic
970874784 4:20856965-20856987 AAGTCTGAGACAAAAGACACAGG + Intronic
973608245 4:52608838-52608860 AAGACAGAGGAAAGAGAAGGTGG + Intronic
977313188 4:95412384-95412406 AAGTGTGAGAAAAGAAAAGCAGG - Intronic
978279029 4:106987542-106987564 CTGCCTGAGGAAAGGGACGCAGG + Intronic
980164870 4:129213578-129213600 AAGACTGAGGAAAGGAACGGAGG - Intergenic
980528491 4:134019829-134019851 AAGATTGATGAAAGAGACACTGG + Intergenic
981419767 4:144535882-144535904 AAGACTCAGGAAGGAGAGGCTGG - Intergenic
981429989 4:144646745-144646767 AAGTTTGGGGAAAGAAACGAAGG + Exonic
983005543 4:162480144-162480166 AAATCTGAGGAAAGAGTCAGGGG - Intergenic
983535563 4:168853541-168853563 AGGCCTGAGGAAAGAGCCTCAGG + Intronic
984135700 4:175935337-175935359 AACTTTGAGGAAAGAGAGGCAGG + Intronic
984444744 4:179822478-179822500 GTGTCTGAGGAAAGTGTCGCAGG + Intergenic
985131052 4:186739044-186739066 AAGGATGAGGAGAGATACGCAGG + Intergenic
985158043 4:187013653-187013675 AAGGATAAGGAAAGAGACTCGGG - Intergenic
987923664 5:24314301-24314323 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
990667882 5:58094241-58094263 AAGTTTGAGGAAAGAGAAGGTGG - Intergenic
991556564 5:67901512-67901534 AAAAATGAGGAAAGAGACACTGG + Intergenic
995899199 5:117048797-117048819 AAGTGAAAGCAAAGAGACGCTGG + Intergenic
997361046 5:133295120-133295142 AAGTCTGAGGAGGGAGAAGAAGG - Intronic
997440222 5:133904024-133904046 CAGTATCAGGAAAGAGACCCTGG - Intergenic
1000043213 5:157500649-157500671 AAATCTAAGGAAACAGACCCAGG - Intronic
1000109457 5:158093964-158093986 AAGTCTAAGGACAGAGCCCCAGG - Intergenic
1001069348 5:168570690-168570712 AAGTCTAAGGAAATAGATGAAGG + Intronic
1001331278 5:170764468-170764490 AAGTGAAAGCAAAGAGACGCTGG + Intronic
1002131226 5:177082872-177082894 AAGGCTGAGGCAGGAGAGGCAGG + Intergenic
1004270352 6:14189707-14189729 AAGTAACAGGAAAGAGAGGCAGG + Intergenic
1004503245 6:16227264-16227286 AGGTGTGGAGAAAGAGACGCGGG - Intergenic
1004606568 6:17200601-17200623 AAGTGTGAAGAGAGAGACGCGGG + Intergenic
1005875380 6:30006921-30006943 GAGTCTGAGGATGAAGACGCGGG + Intergenic
1006425490 6:33960463-33960485 CAGTCTGAGGGAAGAGAGGTTGG - Intergenic
1007187136 6:39981459-39981481 AAGTCTGAGGCAAGGGAGGATGG - Intergenic
1007352124 6:41281668-41281690 AAGACAGAGGAAAGGGAAGCAGG - Intronic
1009260558 6:61480701-61480723 AAGTCCGAGGCAAGAGACCAAGG + Intergenic
1009807894 6:68626120-68626142 AAATCTGAGGCATGAGAAGCGGG + Intergenic
1013552549 6:111222423-111222445 GAGTCTGAGGGCAGAGACTCTGG + Exonic
1013641847 6:112091356-112091378 AAGACTGAGGAAAGAACCACTGG + Intronic
1015826726 6:137320599-137320621 AAAACTGAGCAAAGAGACACGGG + Intergenic
1016471884 6:144383303-144383325 AAGTCTGAGGAAAGAAATTCAGG - Intronic
1016487304 6:144555531-144555553 AAGGCTGAGGCAAGAATCGCTGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018458039 6:163970302-163970324 CAGTCTGAAGAAAGAGGCGCAGG - Intergenic
1020979532 7:15050776-15050798 AAGACAGATGAAAGAGAGGCGGG - Intergenic
1021986970 7:26106549-26106571 CAGTCTGAGGAAAGTGGCACAGG + Intergenic
1022447579 7:30482517-30482539 AAGTGAGAGCAAAGAGAGGCTGG - Intergenic
1023049173 7:36236282-36236304 AAGTGTGAAGAGAGAGGCGCGGG + Intronic
1026637016 7:72092840-72092862 AAGGCAGGGGAAAGAGACCCGGG - Intronic
1027239476 7:76317992-76318014 AAGACGGAGGAGAGAGAAGCGGG + Intergenic
1028340554 7:89714671-89714693 AATTCTGAAGAAAGAGAGGAGGG + Intergenic
1028773604 7:94655796-94655818 AAGCCTGGGGAGAGAGAAGCTGG + Intronic
1029287591 7:99476526-99476548 CAGTCTGAGGAAGGAGCTGCTGG - Intronic
1029691483 7:102184980-102185002 AAGGCTGTGGAAAGAGAATCTGG - Intronic
1030328439 7:108247036-108247058 AAGCCAGTGGAAAGAGACCCTGG + Intronic
1031091376 7:117359424-117359446 AATTCAGAGGAGAGAGACACAGG - Intergenic
1031800583 7:126239145-126239167 AAGTCTGATGAAAGAGGTCCCGG - Intergenic
1032568721 7:132975972-132975994 AAGTTTGGAGAAAGAGACGATGG - Intronic
1032932789 7:136693620-136693642 AAGTCTGAAGAATTAGAGGCTGG + Intergenic
1034483445 7:151341386-151341408 TAGGCTGAGGAATGAGATGCGGG + Intergenic
1034922341 7:155094198-155094220 AACTCTGAGGGAAAAGAGGCAGG - Intergenic
1035309144 7:157953712-157953734 AAGTCTGAGGACTCAGACCCGGG + Intronic
1035388235 7:158488776-158488798 CAGTCTGAGGACAGATGCGCAGG + Intronic
1038262804 8:26011992-26012014 AAGTCTGAGAAAACTGAAGCAGG + Intronic
1041094892 8:54340232-54340254 GAGTCTGAGGCAAGAGAACCCGG - Intergenic
1041281779 8:56217800-56217822 GAGTGTGAGGCAAGAGAAGCTGG + Exonic
1042373973 8:68026962-68026984 AAGTCTGAGGAAAAAGAGATGGG - Intronic
1043788727 8:84435730-84435752 AAGATTCAGGAAAGAGAGGCTGG - Intronic
1046082017 8:109380725-109380747 AAATGTGAGGAAAGAAAAGCTGG - Intronic
1046910489 8:119621022-119621044 ATGTCGGAGGAAAGGGAAGCAGG - Intronic
1048378553 8:133844224-133844246 AAGTCTATGGAAATAGACTCTGG - Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049249783 8:141582124-141582146 TGGGCTGAGGAGAGAGACGCAGG - Intergenic
1050898238 9:10910940-10910962 AAGTGTGAAGAGAGAGGCGCAGG + Intergenic
1051585939 9:18726906-18726928 AGGTCTGAGAAAAGAGACTGGGG - Intronic
1051677817 9:19576368-19576390 AAGTCAGTGGAAAGAGACCTGGG + Intronic
1051923117 9:22291051-22291073 AATTGTGAGGAAATAGACGCTGG - Intergenic
1052352086 9:27468421-27468443 AAGTTTGAGGAAATCGAGGCTGG - Intronic
1053904974 9:42833089-42833111 TATTCTGAGGAAAGAAAAGCAGG - Intergenic
1054363410 9:64202757-64202779 AAGTCCGAGGCAAGAGACCAAGG + Intergenic
1054530012 9:66172428-66172450 TATTCTGAGGAAAGAAAAGCAGG + Intergenic
1056722692 9:89085307-89085329 AAGGCTGAGGGAAGAGACCAGGG - Intronic
1056818070 9:89816090-89816112 AAGTGAGAGGAAAGAAAGGCCGG - Intergenic
1056934145 9:90903109-90903131 AGGTCTGAGGAAAGACAGGAGGG - Intergenic
1057495420 9:95556643-95556665 AACTCTGAGGAAAGCGATGAGGG - Intergenic
1057917990 9:99072218-99072240 AAGTATGAGGAAAGGCAGGCAGG - Intergenic
1061573605 9:131492642-131492664 AAGTCTGAGGAAAGAGACGCTGG - Intronic
1062547840 9:137071551-137071573 AGGCCTGAGGACAGAGACCCAGG - Intergenic
1203467775 Un_GL000220v1:103942-103964 AAGAATGAGGAAAGAAACGAAGG - Intergenic
1203475600 Un_GL000220v1:147918-147940 AAGAATGAGGAAAGAAACGAAGG - Intergenic
1186576338 X:10770141-10770163 CAGTCTGAGGGAAGAGATGAGGG - Intronic
1186914955 X:14208752-14208774 AAAGCTGAGGAAAGAGAGCCAGG - Intergenic
1189138364 X:38574432-38574454 AAGCCTTAGGAAAGAGAGGAAGG + Intronic
1189349617 X:40266925-40266947 AAGGCTCAGGGAAGAGAGGCAGG + Intergenic
1191241502 X:58193619-58193641 AAATCTATGGAAAGAGACACTGG + Intergenic
1195310353 X:103625981-103626003 AGGTGTGAGGAAATAGAAGCAGG - Intronic
1199493777 X:148429932-148429954 AAGTATGAGGAAAGAAACAAAGG + Intergenic
1200418791 Y:2940607-2940629 CAGTCTGGGGAAAAAGAAGCAGG - Intronic