ID: 1061575346

View in Genome Browser
Species Human (GRCh38)
Location 9:131502887-131502909
Sequence GCGCGCGTGCGCACTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061575346_1061575359 29 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575359 9:131502939-131502961 GAATCGAACGTTGAGCAGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 41
1061575346_1061575350 0 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575350 9:131502910-131502932 TGCTGCCCGTCTGGCCCCGCAGG 0: 1
1: 0
2: 2
3: 10
4: 146
1061575346_1061575357 25 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575357 9:131502935-131502957 CGGTGAATCGAACGTTGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 7
1061575346_1061575349 -9 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575349 9:131502901-131502923 CACGCGCGCTGCTGCCCGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 61
1061575346_1061575358 26 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575358 9:131502936-131502958 GGTGAATCGAACGTTGAGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1061575346_1061575352 5 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575352 9:131502915-131502937 CCCGTCTGGCCCCGCAGGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061575346 Original CRISPR GCGCGCGTGCGCACTGGGAG AGG (reversed) Intronic
900218587 1:1495309-1495331 ACGCGTGTGGACACTGGGAGCGG - Intronic
901410395 1:9079017-9079039 CCGCGCGTGGGCACTGGGGTTGG - Intronic
902673815 1:17994354-17994376 GCGGGTGTGCACACTGGGGGAGG + Intergenic
906027141 1:42682957-42682979 GCGCGCGGCCGCAGGGGGAGGGG - Intronic
906320597 1:44813255-44813277 GCGCGCGTGGGCGCGGTGAGTGG + Exonic
906739435 1:48167626-48167648 GGGCACGTGGGCACAGGGAGGGG - Intergenic
907351797 1:53838121-53838143 TCGCGCGTGCGCGCTGGGCGGGG - Intronic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
910183051 1:84506232-84506254 GCGCGCATGCGCACCGAGGGTGG - Exonic
918059519 1:181049211-181049233 TCGCGCCTGATCACTGGGAGAGG + Exonic
920306304 1:205020311-205020333 GCATGCGTGGGCACTGGGTGTGG - Exonic
920524993 1:206659787-206659809 GCGCGCGCACGCACCGGGTGGGG - Intronic
921185466 1:212665958-212665980 CCGCGCGCGCGCACTTGGAGAGG + Intergenic
923193465 1:231642191-231642213 CCGCGGGTCCGCACTCGGAGTGG - Intronic
1065216799 10:23457012-23457034 GCGCGCGCGCGCACAGAGAATGG + Intergenic
1068953865 10:62804841-62804863 GTGCGCGTGCGCGCTCAGAGGGG + Exonic
1079090540 11:17477069-17477091 GCACGCGTGCGCTGGGGGAGAGG + Intergenic
1083753636 11:64777867-64777889 GCGCGCGTGCGCGCACGGGGAGG - Intronic
1085022563 11:73218499-73218521 GCGCAGGTGCGGACTGGGCGCGG + Intronic
1085873925 11:80383829-80383851 TCGAGCTTGCACACTGGGAGGGG - Intergenic
1086458865 11:86985783-86985805 GCCCACCTGCGCACTGGGGGAGG + Intergenic
1089494102 11:118899861-118899883 GCTGGTGTGGGCACTGGGAGCGG - Intronic
1090385488 11:126355700-126355722 GCGCGGGTCCGGCCTGGGAGCGG - Intronic
1091459128 12:630761-630783 GGGTGCGTGCGCCCTGGGCGGGG + Intronic
1095703529 12:45215466-45215488 CCGCGCGAGCACACAGGGAGTGG - Intergenic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1106735674 13:32586296-32586318 GCGCGCGCGCGGACGGGGCGGGG + Intergenic
1107770933 13:43786985-43787007 GCGCGCGCGCCCACGGGGTGGGG + Intergenic
1113655612 13:112066672-112066694 GCGCGCGCGCGCTCAGGAAGCGG + Intergenic
1118019357 14:61695448-61695470 GCGCTCGGGCGCGCGGGGAGGGG - Intergenic
1119710389 14:76817946-76817968 GCTGGAGTGCCCACTGGGAGAGG - Intronic
1124496575 15:30191240-30191262 GCCCGGGTGGGCAATGGGAGGGG - Intergenic
1124747000 15:32347408-32347430 GCCCGGGTGGGCAATGGGAGGGG + Intergenic
1128347390 15:66863110-66863132 GCGTGCCTGTGTACTGGGAGTGG + Intergenic
1128594320 15:68930387-68930409 GCGAGCATGCGCACTAGGAAGGG + Intronic
1129360919 15:75023621-75023643 GCGCGGGTGAGCAGTGGAAGGGG + Exonic
1131061441 15:89407143-89407165 CTGCGCTTGCGGACTGGGAGCGG - Intergenic
1131261793 15:90891490-90891512 GGGGGCGTGAGCCCTGGGAGGGG - Intronic
1136364996 16:29805906-29805928 GCGCGCGTGGCCAGCGGGAGGGG - Intergenic
1137855751 16:51792927-51792949 GCGCGCGCGCGCCCTAGGAAGGG - Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1145126711 17:20306648-20306670 GCGCACGTGCGCGCAGAGAGAGG + Intronic
1147742233 17:42675997-42676019 CCGCACTTGCGAACTGGGAGCGG + Intronic
1147895623 17:43749581-43749603 GGGGGTGTGTGCACTGGGAGGGG - Intergenic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1152386722 17:79979266-79979288 GAGCGCGTGTGCTCTGGGCGTGG - Intronic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1157520507 18:48342151-48342173 GTGCTCCTGGGCACTGGGAGGGG - Intronic
1159574347 18:70157112-70157134 GGGCAAGTGCGCACTGGCAGGGG - Intronic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1162485964 19:10960853-10960875 GCGCGCACGCGCGCCGGGAGCGG + Intergenic
1162753230 19:12841306-12841328 AAGCGCGTGCGCCCTGGGCGCGG + Intronic
1163012244 19:14433445-14433467 GCGCGCGTGCGCCCCGGGCGTGG - Intronic
1165570858 19:36773443-36773465 GCGCGAATGCTCTCTGGGAGCGG + Intronic
1167072778 19:47230543-47230565 GCGGGCGCGCGCCCTGGGTGTGG + Intronic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1168110543 19:54189411-54189433 GCGCGGGGGCGCGCTGGGCGGGG - Exonic
1168408073 19:56121032-56121054 GCGCGCGTGCGCGCTGCTGGGGG - Intronic
925160629 2:1681137-1681159 GCCGGCCTGTGCACTGGGAGGGG + Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
927052911 2:19348053-19348075 TGGCGCTTGCGCAGTGGGAGAGG + Intergenic
928278300 2:29921621-29921643 GCGCGAGCGCGCGCAGGGAGGGG + Intergenic
935301665 2:101698150-101698172 GCGAGCGGGCGCGCGGGGAGCGG + Intronic
935408761 2:102736896-102736918 GCGCGCCTGCGCAGAGAGAGGGG + Intronic
935590842 2:104844571-104844593 GCGCGGGGGCTCACCGGGAGGGG + Intergenic
937533445 2:122857607-122857629 GAGAGAGTGCACACTGGGAGAGG - Intergenic
943589911 2:189784479-189784501 GCGCGCGTGCGTGCTGGGTGCGG + Exonic
947119236 2:226799129-226799151 GCGCGCGCGCGCTCCTGGAGGGG - Exonic
947846924 2:233251950-233251972 GCGCCGGTGCGGGCTGGGAGTGG + Intronic
1173256183 20:41395637-41395659 GCTGGGTTGCGCACTGGGAGTGG + Intergenic
1173516171 20:43667026-43667048 GCGCGCGGGCGCCGGGGGAGGGG - Intronic
1175521358 20:59604423-59604445 AGGCGCGTGGCCACTGGGAGGGG - Intronic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176034927 20:63031569-63031591 CCGCACGTGCCCACTGGGTGGGG - Intergenic
1178584072 21:33858346-33858368 TCTCACCTGCGCACTGGGAGGGG - Intronic
1183649456 22:39145669-39145691 GCGCACGCACGCACGGGGAGGGG + Intronic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1185301399 22:50083042-50083064 GCGAGCTTGGGCACTGGCAGAGG + Intronic
949987804 3:9553623-9553645 GCGCGCGTCCGGCCTGGGCGCGG - Intronic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
957787885 3:84905159-84905181 ACGGGAGTGGGCACTGGGAGTGG - Intergenic
965487754 3:169299318-169299340 GCGTGGGTGTGCACTGGGTGGGG - Intronic
968099021 3:195953112-195953134 GCGTGCGTGAGCACAGGGAAAGG - Intergenic
968306227 3:197653413-197653435 GCGTGCGTGAGCACAGGGAAAGG - Intergenic
976733278 4:88284841-88284863 GCGCGCTTGCGCGGTGGGTGGGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977908461 4:102502365-102502387 GCGCGCGCGCGCACGGAGGGGGG - Intronic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
985316018 4:188659498-188659520 GCGGGGGTGCGCACTGGGGAGGG - Intergenic
985504862 5:272983-273005 GCGTGCGTGAGCACAGGGAAAGG + Intronic
985630945 5:1013701-1013723 GAGAGCGTGCTGACTGGGAGAGG + Intronic
985743250 5:1632612-1632634 GCGTGCGTGAGCACAGGGAAAGG - Intergenic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
996836851 5:127803331-127803353 GCCCACATGTGCACTGGGAGGGG - Intergenic
999374945 5:151080653-151080675 GCGCGCGTGCGCACTGCGCGGGG - Intronic
1002592895 5:180303442-180303464 GGGCGCGGGCGCAATGAGAGTGG + Intronic
1003107575 6:3227836-3227858 GCGGGCGTGCCGACCGGGAGAGG + Intronic
1004075739 6:12342699-12342721 GCCGGCCTGCTCACTGGGAGTGG - Intergenic
1006153209 6:32000398-32000420 GCCCGCGTGGGCACGAGGAGGGG + Intronic
1006159517 6:32033135-32033157 GCCCGCGTGGGCACGAGGAGGGG + Intronic
1006694742 6:35921184-35921206 GCGCGCTTGCGCGTTGGGCGCGG + Exonic
1009723063 6:67500717-67500739 GTGTGCATGCGCACTTGGAGAGG - Intergenic
1010235575 6:73572509-73572531 GCGCACGCACGCACTGGGACTGG - Intergenic
1012475748 6:99613638-99613660 GCGTGCGGGCGCCCCGGGAGCGG + Exonic
1013225061 6:108114956-108114978 GGCTGCGTGCGCGCTGGGAGCGG - Intronic
1013369104 6:109455053-109455075 GCGCCCGGGCGCACAGGGGGCGG - Intronic
1019618499 7:1978066-1978088 GCACGCGGGCGCAGGGGGAGAGG - Intronic
1020192309 7:6009515-6009537 CCGCGCGTGCGCACTGGGCGGGG - Intronic
1023067272 7:36390154-36390176 GCGCGCGTGCGCAGTGTGTGCGG + Intronic
1025916839 7:65873120-65873142 GCGCGCGGGCGCGGAGGGAGGGG - Intergenic
1026091321 7:67302918-67302940 CCGCGCGTGCGCACTTGGCGCGG - Intergenic
1026360451 7:69598088-69598110 CCGGGCCTGCGCACTGGGGGCGG - Intergenic
1026745098 7:73005537-73005559 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027031210 7:74890232-74890254 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027098642 7:75359543-75359565 CCGCGCGTGCGCAGTGGGCGGGG - Intergenic
1027592555 7:80134752-80134774 GCGGGCGCGCGCTCTGGGAGTGG + Intronic
1028477239 7:91265441-91265463 GCGCGCGCTCGCACAGGGAGCGG - Exonic
1029168689 7:98616519-98616541 GCGCGCGAGGGCTCTGCGAGTGG + Intergenic
1029399741 7:100336355-100336377 CCGCGCGTGCGCAGTGGGCGGGG - Intronic
1032087304 7:128890933-128890955 GCGCGGGTGCGCGCAGGGCGCGG + Exonic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1035435511 7:158856543-158856565 ATGCGCAGGCGCACTGGGAGAGG + Intergenic
1036561496 8:9903583-9903605 GTGTGCGTGCGCACTGACAGCGG + Intergenic
1037575270 8:20197170-20197192 GCGCGCGGGCGCAGAGGGAAGGG - Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1043372642 8:79612041-79612063 GCGCGGTTCCGCACTGGGTGGGG - Intronic
1044400303 8:91762953-91762975 GGGCGTGTGGGCAGTGGGAGTGG - Intergenic
1049419444 8:142510510-142510532 GCGCGTGGGCGCACGTGGAGCGG - Intronic
1049584231 8:143425574-143425596 CCCCGCGTGAGCCCTGGGAGAGG - Intronic
1049766794 8:144358713-144358735 GAGCGGGAGCGCACTGGGCGCGG + Exonic
1061575342 9:131502861-131502883 ACGCGCGTGCGCAGCGGGCGAGG - Intergenic
1061575346 9:131502887-131502909 GCGCGCGTGCGCACTGGGAGAGG - Intronic
1061987057 9:134136056-134136078 GTGCGCGTGCGCGAGGGGAGGGG - Intronic
1185610526 X:1391688-1391710 CCACGCGTGCGCACTGGGCCCGG - Intronic
1189310604 X:40014818-40014840 GCGCGCGCGCGCTCGTGGAGCGG - Intergenic
1190845016 X:54183273-54183295 GGGCGCGTGCGCACTCCGCGGGG + Intronic
1200217392 X:154374091-154374113 GCCAGTGTGCCCACTGGGAGGGG - Intronic