ID: 1061575346

View in Genome Browser
Species Human (GRCh38)
Location 9:131502887-131502909
Sequence GCGCGCGTGCGCACTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061575346_1061575357 25 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575357 9:131502935-131502957 CGGTGAATCGAACGTTGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 7
1061575346_1061575349 -9 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575349 9:131502901-131502923 CACGCGCGCTGCTGCCCGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 61
1061575346_1061575350 0 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575350 9:131502910-131502932 TGCTGCCCGTCTGGCCCCGCAGG 0: 1
1: 0
2: 2
3: 10
4: 146
1061575346_1061575358 26 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575358 9:131502936-131502958 GGTGAATCGAACGTTGAGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1061575346_1061575352 5 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575352 9:131502915-131502937 CCCGTCTGGCCCCGCAGGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 166
1061575346_1061575359 29 Left 1061575346 9:131502887-131502909 CCTCTCCCAGTGCGCACGCGCGC 0: 1
1: 0
2: 3
3: 15
4: 119
Right 1061575359 9:131502939-131502961 GAATCGAACGTTGAGCAGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061575346 Original CRISPR GCGCGCGTGCGCACTGGGAG AGG (reversed) Intronic